Rh7CG328300

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
N/A
Physical Location & Seq
Reverse (-)
36016313 .. 36016913
601 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG328300.1

Sequence Viewer

Length: 201 bp
ATGACTCTCACAGCTCAAGAGAAGAAGGACCGTCAGGACTCAAGAGCCGAATTGATTTTTAATTGGATCAATGAAATGGCTGGTCACAGGATTGCTGATGCTGAAGGACCAAGTATTGTCAATAAGATCTGTAGCATCACTGCGCTTGCCTTGGTGCATCACTGGAATGACCACAGGAAAGTGAAGGCACTATTTCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.54

Weight (kDa)

7.98

Isoelectric Point (pI)

28.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 74
AcuI CTGAAG 1 cut(s) 123
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
AlwI GGATC 1 cut(s) 74
AspLEI GCGC 1 cut(s) 145
AspS9I GGNCC 2 cut(s) 28, 107
AvaII GGWCC 2 cut(s) 28, 107
BfmI CTRYAG 1 cut(s) 130
BglII AGATCT 1 cut(s) 126
Bme18I GGWCC 2 cut(s) 28, 107
BmgT120I GGNCC 2 cut(s) 28, 107
BmsI GCATC 3 cut(s) 88, 144, 166
BpuEI CTTGAG 1 cut(s) 25
BsaJI CCNNGG 1 cut(s) 150
Bse1I ACTGG 1 cut(s) 167
BseDI CCNNGG 1 cut(s) 150
BseNI ACTGG 1 cut(s) 167
Bsp143I GATC 2 cut(s) 66, 126
BspPI GGATC 1 cut(s) 74
BsrI ACTGG 1 cut(s) 167
BssECI CCNNGG 1 cut(s) 150
BssMI GATC 2 cut(s) 66, 126
BssT1I CCWWGG 1 cut(s) 150
Bst4CI ACNGT 1 cut(s) 32
BstC8I GCNNGC 1 cut(s) 147
BstHHI GCGC 1 cut(s) 145
BstKTI GATC 2 cut(s) 69, 129
BstMBI GATC 2 cut(s) 66, 126
BstSFI CTRYAG 1 cut(s) 130
BstX2I RGATCY 1 cut(s) 126
BstYI RGATCY 1 cut(s) 126
BtsI GCAGTG 1 cut(s) 138
BtsIMutI CAGTG 2 cut(s) 138, 160
Cac8I GCNNGC 1 cut(s) 147
CfoI GCGC 1 cut(s) 145
Cfr13I GGNCC 2 cut(s) 28, 107
CviAII CATG 1 cut(s) 198
CviJI RGCY 3 cut(s) 14, 47, 80
CviKI_1 RGCY 3 cut(s) 14, 47, 80
DpnI GATC 2 cut(s) 68, 128
DpnII GATC 2 cut(s) 66, 126
Eco130I CCWWGG 1 cut(s) 150
Eco47I GGWCC 2 cut(s) 28, 107
Eco57I CTGAAG 1 cut(s) 123
EcoT14I CCWWGG 1 cut(s) 150
ErhI CCWWGG 1 cut(s) 150
FaeI CATG 1 cut(s) 201
FaiI YATR 1 cut(s) 199
FatI CATG 1 cut(s) 197
GlaI GCGC 1 cut(s) 144
HhaI GCGC 1 cut(s) 145
Hin1II CATG 1 cut(s) 201
Hin6I GCGC 1 cut(s) 143
HinP1I GCGC 1 cut(s) 143
HinfI GANTC 2 cut(s) 4, 38
Hpy188III TCNNGA 3 cut(s) 17, 35, 42
HpyAV CCTTC 3 cut(s) 19, 98, 178
HpyCH4III ACNGT 1 cut(s) 32
HpyCH4V TGCA 1 cut(s) 157
Hsp92II CATG 1 cut(s) 201
HspAI GCGC 1 cut(s) 143
Kzo9I GATC 2 cut(s) 66, 126
LpnPI CCDG 5 cut(s) 20, 66, 73, 148, 160
LweI GCATC 3 cut(s) 88, 144, 166
MaeIII GTNAC 1 cut(s) 83
MalI GATC 2 cut(s) 68, 128
MboI GATC 2 cut(s) 66, 126
MboII GAAGA 1 cut(s) 34
MflI RGATCY 1 cut(s) 126
MluCI AATT 2 cut(s) 50, 61
MlyI GAGTC 1 cut(s) 32
MseI TTAA 1 cut(s) 60
MslI CAYNNNNRTG 1 cut(s) 165
NdeII GATC 2 cut(s) 66, 126
NlaIII CATG 1 cut(s) 201
NmuCI GTSAC 1 cut(s) 83
PleI GAGTC 1 cut(s) 32
PpsI GAGTC 1 cut(s) 32
PspPI GGNCC 2 cut(s) 28, 107
PsuI RGATCY 1 cut(s) 126
RseI CAYNNNNRTG 1 cut(s) 165
SaqAI TTAA 1 cut(s) 60
Sau3AI GATC 2 cut(s) 66, 126
Sau96I GGNCC 2 cut(s) 28, 107
SchI GAGTC 1 cut(s) 32
SetI ASST 1 cut(s) 16
SfaNI GCATC 3 cut(s) 88, 144, 166
SfcI CTRYAG 1 cut(s) 130
SinI GGWCC 2 cut(s) 28, 107
SmiMI CAYNNNNRTG 1 cut(s) 165
SmlI CTYRAG 2 cut(s) 15, 40
SmoI CTYRAG 2 cut(s) 15, 40
Sse9I AATT 2 cut(s) 50, 61
StyI CCWWGG 1 cut(s) 150
TaaI ACNGT 1 cut(s) 32
TasI AATT 2 cut(s) 50, 61
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TscAI CASTG 2 cut(s) 145, 167
TseFI GTSAC 1 cut(s) 83
Tsp45I GTSAC 1 cut(s) 83
TspDTI ATGAA 1 cut(s) 87
TspRI CASTG 2 cut(s) 145, 167
VpaK11BI GGWCC 2 cut(s) 28, 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.