Rh7DG077100

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
N/A
Physical Location & Seq
Forward (+)
6102380 .. 6103146
767 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG077100.1

Sequence Viewer

Length: 189 bp
ATGAGTAAAGTGATTGAAATGTTGGAAGGAAGCACTGAAGCCTTGCAAATACCACCAAAGCCTGTCCTATCTTCTCCTGTACAGCAATTCACATCAAACAAATCTGACAGCATTGTTTTGCTACTGTACATAAACATACACAAGCAGTGTAATGTTCTGTTCTGGTTGTCTACCTTGGTTGTGTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

62

Amino Acids

6.98

Weight (kDa)

6.52

Isoelectric Point (pI)

73.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 170
AcuI CTGAAG 1 cut(s) 57
AfaI GTAC 2 cut(s) 81, 128
AgsI TTSAA 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 174
BseDI CCNNGG 1 cut(s) 174
Bsp1407I TGTACA 2 cut(s) 79, 126
BsrGI TGTACA 2 cut(s) 79, 126
BssECI CCNNGG 1 cut(s) 174
BssT1I CCWWGG 1 cut(s) 174
Bst4CI ACNGT 1 cut(s) 126
BstAUI TGTACA 2 cut(s) 79, 126
BtsI GCAGTG 1 cut(s) 152
BtsIMutI CAGTG 2 cut(s) 33, 152
Csp6I GTAC 2 cut(s) 80, 127
CviJI RGCY 2 cut(s) 41, 61
CviKI_1 RGCY 2 cut(s) 41, 61
CviQI GTAC 2 cut(s) 80, 127
Eco130I CCWWGG 1 cut(s) 174
Eco57I CTGAAG 1 cut(s) 57
EcoT14I CCWWGG 1 cut(s) 174
ErhI CCWWGG 1 cut(s) 174
FaiI YATR 2 cut(s) 131, 137
FblI GTMKAC 1 cut(s) 170
Hpy166II GTNNAC 1 cut(s) 171
Hpy188I TCNGA 2 cut(s) 106, 188
Hpy8I GTNNAC 1 cut(s) 171
HpyAV CCTTC 1 cut(s) 20
HpyCH4III ACNGT 1 cut(s) 126
HpyCH4V TGCA 1 cut(s) 46
LpnPI CCDG 3 cut(s) 75, 90, 148
MboII GAAGA 1 cut(s) 63
MluCI AATT 1 cut(s) 86
RsaI GTAC 2 cut(s) 81, 128
RsaNI GTAC 2 cut(s) 80, 127
SetI ASST 1 cut(s) 176
SgeI CNNG 5 cut(s) 55, 74, 89, 154, 175
Sse9I AATT 1 cut(s) 86
StyI CCWWGG 1 cut(s) 174
TaaI ACNGT 1 cut(s) 126
TasI AATT 1 cut(s) 86
TatI WGTACW 2 cut(s) 79, 126
TscAI CASTG 2 cut(s) 40, 152
TspRI CASTG 2 cut(s) 40, 152
XmiI GTMKAC 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.