Rw3G013730

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
N/A
Physical Location & Seq
Reverse (-)
13555032 .. 13562643
7612 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G013730.1

Sequence Viewer

Length: 471 bp
ATGGATGCCCTATGTAACGACGAGCTAGGACTAATCTTGAACTGGGTCTGTAAGCAATGGTGGGTAGCGGAGGGTCGGAACCGATCATGCATTCGTGTTCTCGAACTCGATCGTCTCCCTCGATCACTTGATAGATTTCCAAACTTGGTCACATTCCAAACATCCCTGTCTCTAAGCAACGCTGACCTCGAATTATTAGCCCAAAGATGTCCCAAACTAGAGGTCATCGACCTTACAACACCGCTTAGTAAATTCTTCTCATCCTCATTGCTCAGGGTGTTTCTATCAATTGTTCAAACAAAGCGACACCATCTGACGACTAAATTAGCTAGGGAGAAGGTAATACAAGTAGCAATCCATGACAGGCCCTGTGAAATCATAAAGATCGGGTACTCGAATGGTGGGTTTCGCGCACGATATAAGATCGACAAGGGGAAATTTGACAAACGTGTGAAGCGTTTTAAGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

156

Amino Acids

18.13

Weight (kDa)

9.88

Isoelectric Point (pI)

26.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 411
AciI CCGC 2 cut(s) 68, 242
AcsI RAATTY 2 cut(s) 251, 437
AfaI GTAC 1 cut(s) 392
AflIII ACRYGT 1 cut(s) 448
AgsI TTSAA 2 cut(s) 40, 296
AluBI AGCT 2 cut(s) 25, 329
AluI AGCT 2 cut(s) 25, 329
Alw26I GTCTC 2 cut(s) 119, 174
AlwNI CAGNNNCTG 1 cut(s) 369
AoxI GGCC 1 cut(s) 365
ApoI RAATTY 2 cut(s) 251, 437
ArsI GACNNNNNNTTYG 2 cut(s) 207, 239
AspLEI GCGC 1 cut(s) 413
AspS9I GGNCC 1 cut(s) 366
BccI CCATC 1 cut(s) 318
BcoDI GTCTC 2 cut(s) 119, 174
BfaI CTAG 3 cut(s) 26, 218, 330
BmgT120I GGNCC 1 cut(s) 366
BmiI GGNNCC 1 cut(s) 80
BmrI ACTGGG 1 cut(s) 52
BmuI ACTGGG 1 cut(s) 52
Bpu10I CCTNAGC 1 cut(s) 272
Bse1I ACTGG 1 cut(s) 47
Bse3DI GCAATG 2 cut(s) 62, 266
BseGI GGATG 3 cut(s) 10, 161, 260
BseMI GCAATG 2 cut(s) 62, 266
BseMII CTCAG 1 cut(s) 286
BseNI ACTGG 1 cut(s) 47
Bsh1236I CGCG 1 cut(s) 411
Bsh1285I CGRYCG 1 cut(s) 112
BshFI GGCC 1 cut(s) 367
BsiEI CGRYCG 1 cut(s) 112
BslFI GGGAC 1 cut(s) 195
BsmAI GTCTC 2 cut(s) 119, 174
BsmBI CGTCTC 1 cut(s) 119
BsmFI GGGAC 1 cut(s) 195
BsmI GAATGC 1 cut(s) 90
BsnI GGCC 1 cut(s) 367
Bsp143I GATC 5 cut(s) 83, 109, 122, 384, 423
BspACI CCGC 2 cut(s) 68, 242
BspANI GGCC 1 cut(s) 367
BspCNI CTCAG 1 cut(s) 285
BspFNI CGCG 1 cut(s) 411
BspLI GGNNCC 1 cut(s) 80
BsrDI GCAATG 2 cut(s) 62, 266
BsrI ACTGG 1 cut(s) 47
BssMI GATC 5 cut(s) 83, 109, 122, 384, 423
BstDEI CTNAG 3 cut(s) 173, 245, 272
BstF5I GGATG 3 cut(s) 10, 161, 260
BstFNI CGCG 1 cut(s) 411
BstHHI GCGC 1 cut(s) 413
BstKTI GATC 5 cut(s) 86, 112, 125, 387, 426
BstMAI GTCTC 2 cut(s) 119, 174
BstMBI GATC 5 cut(s) 83, 109, 122, 384, 423
BstMCI CGRYCG 1 cut(s) 112
BstUI CGCG 1 cut(s) 411
BsuRI GGCC 1 cut(s) 367
BtsCI GGATG 3 cut(s) 10, 161, 260
CaiI CAGNNNCTG 1 cut(s) 369
CfoI GCGC 1 cut(s) 413
Cfr13I GGNCC 1 cut(s) 366
Csp6I GTAC 1 cut(s) 391
CviAII CATG 2 cut(s) 87, 359
CviJI RGCY 4 cut(s) 25, 200, 329, 367
CviKI_1 RGCY 4 cut(s) 25, 200, 329, 367
CviQI GTAC 1 cut(s) 391
DdeI CTNAG 3 cut(s) 173, 245, 272
DpnI GATC 5 cut(s) 85, 111, 124, 386, 425
DpnII GATC 5 cut(s) 83, 109, 122, 384, 423
EcoO109I RGGNCCY 1 cut(s) 366
EcoT22I ATGCAT 1 cut(s) 92
Esp3I CGTCTC 1 cut(s) 119
FaeI CATG 2 cut(s) 90, 362
FaiI YATR 5 cut(s) 13, 88, 360, 380, 420
FaqI GGGAC 1 cut(s) 195
FatI CATG 2 cut(s) 86, 358
FokI GGATG 3 cut(s) 17, 148, 247
FspBI CTAG 3 cut(s) 26, 218, 330
GlaI GCGC 1 cut(s) 412
HaeIII GGCC 1 cut(s) 367
HhaI GCGC 1 cut(s) 413
Hin1II CATG 2 cut(s) 90, 362
Hin6I GCGC 1 cut(s) 411
HinP1I GCGC 1 cut(s) 411
Hpy188I TCNGA 2 cut(s) 78, 315
Hpy188III TCNNGA 2 cut(s) 37, 101
Hpy99I CGWCG 1 cut(s) 23
HpyAV CCTTC 1 cut(s) 331
HpyCH4IV ACGT 1 cut(s) 448
HpyCH4V TGCA 1 cut(s) 90
HpyF3I CTNAG 3 cut(s) 173, 245, 272
HpySE526I ACGT 1 cut(s) 448
Hsp92II CATG 2 cut(s) 90, 362
HspAI GCGC 1 cut(s) 411
Kzo9I GATC 5 cut(s) 83, 109, 122, 384, 423
LpnPI CCDG 5 cut(s) 28, 179, 259, 349, 382
MaeI CTAG 3 cut(s) 26, 218, 330
MaeII ACGT 1 cut(s) 448
MaeIII GTNAC 2 cut(s) 14, 148
MalI GATC 5 cut(s) 85, 111, 124, 386, 425
MboI GATC 5 cut(s) 83, 109, 122, 384, 423
MboII GAAGA 1 cut(s) 247
MfeI CAATTG 1 cut(s) 288
MluCI AATT 6 cut(s) 191, 251, 288, 323, 437, 466
MmeI TCCRAC 1 cut(s) 56
MnlI CCTC 5 cut(s) 64, 129, 197, 214, 274
Mph1103I ATGCAT 1 cut(s) 92
MseI TTAA 1 cut(s) 462
MunI CAATTG 1 cut(s) 288
Mva1269I GAATGC 1 cut(s) 90
MvnI CGCG 1 cut(s) 411
NdeII GATC 5 cut(s) 83, 109, 122, 384, 423
NlaIII CATG 2 cut(s) 90, 362
NlaIV GGNNCC 1 cut(s) 80
NmuCI GTSAC 1 cut(s) 148
NsiI ATGCAT 1 cut(s) 92
PcsI WCGNNNNNNNCGW 3 cut(s) 118, 186, 454
PctI GAATGC 1 cut(s) 90
Ple19I CGATCG 1 cut(s) 112
PspN4I GGNNCC 1 cut(s) 80
PspPI GGNCC 1 cut(s) 366
PstNI CAGNNNCTG 1 cut(s) 369
PvuI CGATCG 1 cut(s) 112
RsaI GTAC 1 cut(s) 392
RsaNI GTAC 1 cut(s) 391
SaqAI TTAA 1 cut(s) 462
Sau3AI GATC 5 cut(s) 83, 109, 122, 384, 423
Sau96I GGNCC 1 cut(s) 366
SetI ASST 7 cut(s) 27, 189, 225, 234, 331, 342, 451
Sse9I AATT 6 cut(s) 191, 251, 288, 323, 437, 466
SsiI CCGC 2 cut(s) 68, 242
SspMI CTAG 3 cut(s) 26, 218, 330
TaiI ACGT 1 cut(s) 451
TaqI TCGA 7 cut(s) 102, 108, 121, 189, 228, 395, 426
TasI AATT 6 cut(s) 191, 251, 288, 323, 437, 466
Tru1I TTAA 1 cut(s) 462
Tru9I TTAA 1 cut(s) 462
TseFI GTSAC 1 cut(s) 148
Tsp45I GTSAC 1 cut(s) 148
XapI RAATTY 2 cut(s) 251, 437
XspI CTAG 3 cut(s) 26, 218, 330
Zsp2I ATGCAT 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.