Rw3G020730

serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
N/A
Physical Location & Seq
Forward (+)
24651165 .. 24668109
16945 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G020730.1

Sequence Viewer

Length: 465 bp
ATGAGCATTACACTGGAAAGGGTTGCCAATTGCTTGACATGGTATGACGACTTGATGGACATGTTAGTTTACACAGGGGCCGGACGAGATCTATATGTTCGTGTGGATAAAATTTCATTAGCTGAGGCCAGAAACTCACAAGGTTTCTTCAGGAGTGGCAAGGTCCTTATTCCAATACTAACTGCTCTGGTGGCACTACTACTAATCATTATACTTTCCTTGTGGTTGCTTAAGAAAAAGAGGAAGACAAGAGACTATTTGGATGCGGAGGAACTTGAGGAAACTAAGAGACACCCGGAATTGCAATTTTTCGATCTTAACACACTAATTGCAGCCACAGACAACTTCTCTGATGCCAATAAACTCGGCCAAGGTGGTTTTGGCAGTGTTTATAAGGTAATTAAACCCATATCAGGTAGCTTATTGTTTCTTACTGCAGCTACTCCTCAAAAGTTTTATCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin DUF3403 PAN_2 Pkinase Pkinase_Tyr S_locus_glycop

Protein Analysis

154

Amino Acids

17.39

Weight (kDa)

8.64

Isoelectric Point (pI)

32.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 393
AciI CCGC 1 cut(s) 266
AcoI YGGCCR 1 cut(s) 367
AcsI RAATTY 1 cut(s) 111
AcuI CTGAAG 1 cut(s) 133
AfiI CCNNNNNNNGG 1 cut(s) 413
AflII CTTAAG 1 cut(s) 230
AflIII ACRYGT 1 cut(s) 60
AluBI AGCT 3 cut(s) 122, 420, 440
AluI AGCT 3 cut(s) 122, 420, 440
Alw26I GTCTC 2 cut(s) 246, 283
AoxI GGCC 3 cut(s) 78, 126, 367
ApeKI GCWGC 2 cut(s) 332, 437
ApoI RAATTY 1 cut(s) 111
AspS9I GGNCC 2 cut(s) 78, 163
AsuC2I CCSGG 1 cut(s) 296
AvaII GGWCC 1 cut(s) 163
BbsI GAAGAC 1 cut(s) 251
BbvCI CCTCAGC 1 cut(s) 123
BbvI GCAGC 2 cut(s) 344, 449
BccI CCATC 1 cut(s) 49
BcnI CCSGG 1 cut(s) 296
BcoDI GTCTC 2 cut(s) 246, 283
BfmI CTRYAG 1 cut(s) 435
BfrI CTTAAG 1 cut(s) 230
BglII AGATCT 1 cut(s) 88
BisI GCNGC 2 cut(s) 333, 438
BlsI GCNGC 2 cut(s) 334, 439
Bme1390I CCNGG 1 cut(s) 296
Bme18I GGWCC 1 cut(s) 163
BmgT120I GGNCC 2 cut(s) 78, 163
BmiI GGNNCC 1 cut(s) 79
BmrFI CCNGG 1 cut(s) 296
BmsI GCATC 2 cut(s) 253, 343
BpiI GAAGAC 1 cut(s) 251
Bpu10I CCTNAGC 1 cut(s) 123
BpuEI CTTGAG 1 cut(s) 296
BpuMI CCSGG 1 cut(s) 296
BsaJI CCNNGG 1 cut(s) 370
Bsc4I CCNNNNNNNGG 1 cut(s) 413
Bse1I ACTGG 1 cut(s) 18
BseDI CCNNGG 1 cut(s) 370
BseGI GGATG 1 cut(s) 268
BseLI CCNNNNNNNGG 1 cut(s) 413
BseMII CTCAG 1 cut(s) 114
BseNI ACTGG 1 cut(s) 18
BseRI GAGGAG 1 cut(s) 435
BseXI GCAGC 2 cut(s) 344, 449
BshFI GGCC 3 cut(s) 80, 128, 369
BsiSI CCGG 2 cut(s) 81, 296
BslI CCNNNNNNNGG 1 cut(s) 413
BsmAI GTCTC 2 cut(s) 246, 283
BsnI GGCC 3 cut(s) 80, 128, 369
Bsp143I GATC 2 cut(s) 88, 313
BspACI CCGC 1 cut(s) 266
BspANI GGCC 3 cut(s) 80, 128, 369
BspCNI CTCAG 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 79
BspMAI CTGCAG 1 cut(s) 439
BspTI CTTAAG 1 cut(s) 230
BsrI ACTGG 1 cut(s) 18
BssECI CCNNGG 1 cut(s) 370
BssMI GATC 2 cut(s) 88, 313
BssT1I CCWWGG 1 cut(s) 370
BstAFI CTTAAG 1 cut(s) 230
BstDEI CTNAG 2 cut(s) 123, 285
BstF5I GGATG 1 cut(s) 268
BstKTI GATC 2 cut(s) 91, 316
BstMAI GTCTC 2 cut(s) 246, 283
BstMBI GATC 2 cut(s) 88, 313
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstNSI RCATGY 1 cut(s) 64
BstSCI CCNGG 1 cut(s) 294
BstSFI CTRYAG 1 cut(s) 435
BstV1I GCAGC 2 cut(s) 344, 449
BstV2I GAAGAC 1 cut(s) 251
BstX2I RGATCY 1 cut(s) 88
BstYI RGATCY 1 cut(s) 88
BsuRI GGCC 3 cut(s) 80, 128, 369
BtsCI GGATG 1 cut(s) 268
BtsI GCAGTG 1 cut(s) 391
BtsIMutI CAGTG 2 cut(s) 11, 391
Cfr13I GGNCC 2 cut(s) 78, 163
CviAII CATG 2 cut(s) 39, 61
CviJI RGCY 7 cut(s) 80, 122, 128, 335, 369, 420, 440
CviKI_1 RGCY 7 cut(s) 80, 122, 128, 335, 369, 420, 440
DdeI CTNAG 2 cut(s) 123, 285
DpnI GATC 2 cut(s) 90, 315
DpnII GATC 2 cut(s) 88, 313
EaeI YGGCCR 1 cut(s) 367
Eco130I CCWWGG 1 cut(s) 370
Eco47I GGWCC 1 cut(s) 163
Eco57I CTGAAG 1 cut(s) 133
EcoO109I RGGNCCY 1 cut(s) 163
EcoT14I CCWWGG 1 cut(s) 370
ErhI CCWWGG 1 cut(s) 370
FaeI CATG 2 cut(s) 42, 64
FaiI YATR 8 cut(s) 40, 45, 62, 94, 96, 212, 393, 410
FatI CATG 2 cut(s) 38, 60
Fnu4HI GCNGC 2 cut(s) 333, 438
FokI GGATG 1 cut(s) 275
Fsp4HI GCNGC 2 cut(s) 333, 438
GluI GCNGC 2 cut(s) 333, 438
HaeIII GGCC 3 cut(s) 80, 128, 369
HapII CCGG 2 cut(s) 81, 296
Hin1II CATG 2 cut(s) 42, 64
HpaII CCGG 2 cut(s) 81, 296
Hpy166II GTNNAC 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 352
Hpy188III TCNNGA 1 cut(s) 151
Hpy8I GTNNAC 1 cut(s) 70
HpyCH4V TGCA 3 cut(s) 304, 332, 437
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
HpyF3I CTNAG 2 cut(s) 123, 285
Hsp92II CATG 2 cut(s) 42, 64
Kzo9I GATC 2 cut(s) 88, 313
LpnPI CCDG 7 cut(s) 60, 94, 136, 142, 173, 309, 399
Lsp1109I GCAGC 2 cut(s) 344, 449
LweI GCATC 2 cut(s) 253, 343
MalI GATC 2 cut(s) 90, 315
MboI GATC 2 cut(s) 88, 313
MboII GAAGA 2 cut(s) 139, 256
MfeI CAATTG 1 cut(s) 28
MflI RGATCY 1 cut(s) 88
MluCI AATT 6 cut(s) 28, 111, 299, 305, 327, 399
MnlI CCTC 5 cut(s) 118, 234, 262, 271, 456
MseI TTAA 3 cut(s) 231, 318, 402
MspCI CTTAAG 1 cut(s) 230
MspI CCGG 2 cut(s) 81, 296
MspR9I CCNGG 1 cut(s) 296
MunI CAATTG 1 cut(s) 28
MwoI GCNNNNNNNGC 1 cut(s) 191
NciI CCSGG 1 cut(s) 296
NdeII GATC 2 cut(s) 88, 313
NlaIII CATG 2 cut(s) 42, 64
NlaIV GGNNCC 1 cut(s) 79
NmeAIII GCCGAG 1 cut(s) 345
NspI RCATGY 1 cut(s) 64
PciI ACATGT 1 cut(s) 60
PkrI GCNGC 2 cut(s) 334, 439
PpuMI RGGWCCY 1 cut(s) 163
PscI ACATGT 1 cut(s) 60
PsiI TTATAA 1 cut(s) 393
Psp5II RGGWCCY 1 cut(s) 163
PspN4I GGNNCC 1 cut(s) 79
PspPI GGNCC 2 cut(s) 78, 163
PspPPI RGGWCCY 1 cut(s) 163
PstI CTGCAG 1 cut(s) 439
PsuI RGATCY 1 cut(s) 88
SaqAI TTAA 3 cut(s) 231, 318, 402
SatI GCNGC 2 cut(s) 333, 438
Sau3AI GATC 2 cut(s) 88, 313
Sau96I GGNCC 2 cut(s) 78, 163
ScrFI CCNGG 1 cut(s) 296
SetI ASST 8 cut(s) 124, 145, 165, 376, 399, 418, 422, 442
SfaNI GCATC 2 cut(s) 253, 343
SfcI CTRYAG 1 cut(s) 435
SinI GGWCC 1 cut(s) 163
SmlI CTYRAG 2 cut(s) 230, 275
SmoI CTYRAG 2 cut(s) 230, 275
Sse9I AATT 6 cut(s) 28, 111, 299, 305, 327, 399
SsiI CCGC 1 cut(s) 266
StyD4I CCNGG 1 cut(s) 294
StyI CCWWGG 1 cut(s) 370
TaqI TCGA 1 cut(s) 312
TasI AATT 6 cut(s) 28, 111, 299, 305, 327, 399
Tru1I TTAA 3 cut(s) 231, 318, 402
Tru9I TTAA 3 cut(s) 231, 318, 402
TscAI CASTG 2 cut(s) 18, 391
TseI GCWGC 2 cut(s) 332, 437
TspDTI ATGAA 1 cut(s) 105
TspRI CASTG 2 cut(s) 18, 391
Vha464I CTTAAG 1 cut(s) 230
VpaK11BI GGWCC 1 cut(s) 163
XapI RAATTY 1 cut(s) 111
XceI RCATGY 1 cut(s) 64
XcmI CCANNNNNNNNNTGG 1 cut(s) 377
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.