AT2G12905

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
5296364 .. 5296582
219 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G12905.1

Sequence Viewer

Length: 219 bp
ATGGTTCCGGTATTACAGATCAATCTTACTACACTAATACAATATACAAATAGGAGGCATAGGGGAAGAAGCACTACGCCGAGAAATCAACAACACAAAAACTTTCTTAAAAATGATTCCCTTTCTTTCTTCTTCTTTGTTGGGATTGGGACTAATCAAAATGGTTGGAACAATAAACATCCATCTCGTTCGTACTTTGGATACCCGTATAACCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.56

Weight (kDa)

11.04

Isoelectric Point (pI)

45.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0026916)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G12905
pyrus_communis pycom12g12170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 194
BarI GAAGNNNNNNTAC 2 cut(s) 58, 90
BccI CCATC 1 cut(s) 190
BciVI GTATCC 1 cut(s) 194
BfuI GTATCC 1 cut(s) 194
BmiI GGNNCC 1 cut(s) 6
BsaWI WCCGGW 1 cut(s) 7
BseGI GGATG 1 cut(s) 178
BsiSI CCGG 1 cut(s) 8
BslFI GGGAC 1 cut(s) 163
BsmFI GGGAC 1 cut(s) 163
Bsp143I GATC 1 cut(s) 18
BspLI GGNNCC 1 cut(s) 6
BssMI GATC 1 cut(s) 18
BstF5I GGATG 1 cut(s) 178
BstKTI GATC 1 cut(s) 21
BstMBI GATC 1 cut(s) 18
BsuI GTATCC 1 cut(s) 194
BtsCI GGATG 1 cut(s) 178
Csp6I GTAC 1 cut(s) 193
CviQI GTAC 1 cut(s) 193
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
FaiI YATR 3 cut(s) 45, 60, 210
FaqI GGGAC 1 cut(s) 163
FokI GGATG 1 cut(s) 165
HapII CCGG 1 cut(s) 8
HinfI GANTC 1 cut(s) 116
HpaII CCGG 1 cut(s) 8
Kzo9I GATC 1 cut(s) 18
LpnPI CCDG 1 cut(s) 21
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MboII GAAGA 3 cut(s) 78, 121, 124
MmeI TCCRAC 1 cut(s) 146
MnlI CCTC 1 cut(s) 48
MseI TTAA 1 cut(s) 108
MspI CCGG 1 cut(s) 8
NdeII GATC 1 cut(s) 18
NlaIV GGNNCC 1 cut(s) 6
NmeAIII GCCGAG 1 cut(s) 105
PfeI GAWTC 1 cut(s) 116
PspN4I GGNNCC 1 cut(s) 6
RsaI GTAC 1 cut(s) 194
RsaNI GTAC 1 cut(s) 193
SaqAI TTAA 1 cut(s) 108
Sau3AI GATC 1 cut(s) 18
SgeI CNNG 3 cut(s) 20, 93, 198
TfiI GAWTC 1 cut(s) 116
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.