Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0026844

Physical Location & Seq

Genomic Coordinates Reverse (-)

13687847 .. 13689596

Gene Structure 1750 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT5G35480.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 117 bp

ATGAAAAAAAGTAGAGGCTCATCATTCAATCAATATGAAGATGAGTTGTTATGTTGTGTATATTTAGAAATATCACAAGATCCAATTGGTAGTAATAACCAATCTGGGAAAAAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NAM-associated

Protein Analysis

38

Amino Acids

4.3

Weight (kDa)

6.03

Isoelectric Point (pI)

35.34

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0026844)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G35480 AT5G35480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	74
AgsI	TTSAA	1 cut(s)	28
AlwI	GGATC	1 cut(s)	74
Bsp143I	GATC	1 cut(s)	79
BspPI	GGATC	1 cut(s)	74
BssMI	GATC	1 cut(s)	79
BstKTI	GATC	1 cut(s)	82
BstMBI	GATC	1 cut(s)	79
BstX2I	RGATCY	1 cut(s)	79
BstYI	RGATCY	1 cut(s)	79
CviJI	RGCY	1 cut(s)	18
CviKI_1	RGCY	1 cut(s)	18
DpnI	GATC	1 cut(s)	81
DpnII	GATC	1 cut(s)	79
FaiI	YATR	3 cut(s)	36, 52, 61
FspEI	CC	5 cut(s)	72, 90, 91, 96, 113
Kzo9I	GATC	1 cut(s)	79
LpnPI	CCDG	1 cut(s)	90
MalI	GATC	1 cut(s)	81
MboI	GATC	1 cut(s)	79
MboII	GAAGA	1 cut(s)	50
MfeI	CAATTG	1 cut(s)	84
MflI	RGATCY	1 cut(s)	79
MluCI	AATT	1 cut(s)	84
MnlI	CCTC	1 cut(s)	8
MunI	CAATTG	1 cut(s)	84
NdeII	GATC	1 cut(s)	79
PsuI	RGATCY	1 cut(s)	79
Sau3AI	GATC	1 cut(s)	79
SgeI	CNNG	1 cut(s)	89
Sse9I	AATT	1 cut(s)	84
TasI	AATT	1 cut(s)	84
TspDTI	ATGAA	2 cut(s)	17, 51

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.