ATCG00640

50S ribosomal protein L33, chloroplastic

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
Pt
OG0022039
Physical Location & Seq
Forward (+)
67488 .. 67688
201 bp
Loading structure...
UTR
Exon/CDS
Intron
ATCG00640.1

Sequence Viewer

Length: 201 bp
ATGGCCAAGGGTAAAGATGTTCGAGTAACAATTATTTTGGAATGTACCAGTTGTGTTCGAAATGATATTAAGAAAGAAGCCGCGGGAATTTCCAGATATATTACTCAAAAGAATCGGCATAACACCCCTAGTCGATTGGAATTGAGAAAATTCTGTCCCTATTGTTATAAACATACAATTCACGGGGAAATCAAGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L33

Protein Analysis

66

Amino Acids

7.69

Weight (kDa)

9.78

Isoelectric Point (pI)

42.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L33 PF00471 10 - 65 7.7e-21 Ribosomal protein L33
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022039)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00640
rosa_chinensis RchiOBHm_CPg0502021
rosa_roxburghii Rroxscaffold_2G00119040
rosa_wichuraiana Rw2G016980

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 168
AccII CGCG 1 cut(s) 83
AciI CCGC 2 cut(s) 81, 83
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 87, 149
AfaI GTAC 1 cut(s) 46
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 2 cut(s) 87, 149
AsuII TTCGAA 1 cut(s) 58
BalI TGGCCA 1 cut(s) 5
BfaI CTAG 1 cut(s) 129
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
Bpu14I TTCGAA 1 cut(s) 58
BsaJI CCNNGG 2 cut(s) 6, 81
Bse1I ACTGG 1 cut(s) 48
BseDI CCNNGG 2 cut(s) 6, 81
BseNI ACTGG 1 cut(s) 48
Bsh1236I CGCG 1 cut(s) 83
BshFI GGCC 1 cut(s) 5
BslFI GGGAC 1 cut(s) 141
BsmFI GGGAC 1 cut(s) 141
BsnI GGCC 1 cut(s) 5
Bsp119I TTCGAA 1 cut(s) 58
BspACI CCGC 2 cut(s) 81, 83
BspANI GGCC 1 cut(s) 5
BspFNI CGCG 1 cut(s) 83
BspT104I TTCGAA 1 cut(s) 58
BsrI ACTGG 1 cut(s) 48
BssECI CCNNGG 2 cut(s) 6, 81
BssT1I CCWWGG 1 cut(s) 6
BstBI TTCGAA 1 cut(s) 58
BstDSI CCRYGG 1 cut(s) 81
BstFNI CGCG 1 cut(s) 83
BstUI CGCG 1 cut(s) 83
BsuRI GGCC 1 cut(s) 5
BtgI CCRYGG 1 cut(s) 81
Cfr42I CCGCGG 1 cut(s) 84
Csp6I GTAC 1 cut(s) 45
CviJI RGCY 2 cut(s) 5, 80
CviKI_1 RGCY 2 cut(s) 5, 80
CviQI GTAC 1 cut(s) 45
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 6
EcoT14I CCWWGG 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 6
FaiI YATR 4 cut(s) 99, 120, 168, 174
FaqI GGGAC 1 cut(s) 141
FauI CCCGC 1 cut(s) 76
Fnu4HI GCNGC 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 81
FspBI CTAG 1 cut(s) 129
GluI GCNGC 1 cut(s) 81
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 1 cut(s) 112
Hpy188III TCNNGA 2 cut(s) 93, 193
KspI CCGCGG 1 cut(s) 84
LpnPI CCDG 2 cut(s) 61, 106
MaeI CTAG 1 cut(s) 129
MaeIII GTNAC 1 cut(s) 25
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 5 cut(s) 30, 87, 140, 149, 177
MluNI TGGCCA 1 cut(s) 5
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 69
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 83
MvnI CGCG 1 cut(s) 83
NspV TTCGAA 1 cut(s) 58
PfeI GAWTC 1 cut(s) 112
PkrI GCNGC 1 cut(s) 82
PsiI TTATAA 1 cut(s) 168
RsaI GTAC 1 cut(s) 46
RsaNI GTAC 1 cut(s) 45
SacII CCGCGG 1 cut(s) 84
SaqAI TTAA 1 cut(s) 69
SatI GCNGC 1 cut(s) 81
Sfr303I CCGCGG 1 cut(s) 84
SfuI TTCGAA 1 cut(s) 58
SgeI CNNG 9 cut(s) 19, 35, 60, 94, 96, 105, 141, 194, 196
SgrBI CCGCGG 1 cut(s) 84
Sse9I AATT 5 cut(s) 30, 87, 140, 149, 177
SsiI CCGC 2 cut(s) 81, 83
SspMI CTAG 1 cut(s) 129
StyI CCWWGG 1 cut(s) 6
TaqI TCGA 3 cut(s) 22, 58, 133
TasI AATT 5 cut(s) 30, 87, 140, 149, 177
TauI GCSGC 1 cut(s) 83
TfiI GAWTC 1 cut(s) 112
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
XapI RAATTY 2 cut(s) 87, 149
XspI CTAG 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.