ATCG01060

essential for photochemical activity. FB is the terminal electron acceptor of PSI, donating electrons to ferredoxin. The C-terminus interacts with PsaA B D and helps assemble the protein into the PSI complex. Required for binding of PsaD and PsaE to PSI. PSI is a plastocyanin-ferredoxin oxidoreductase, converting photonic excitation into a charge separation, which transfers an electron from the donor P700 chlorophyll pair to the spectroscopically characterized acceptors A0, A1, FX, FA and FB in turn

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
Pt
Physical Location & Seq
Reverse (-)
117318 .. 117563
246 bp
Loading structure...
UTR
Exon/CDS
Intron
ATCG01060.1

Sequence Viewer

Length: 246 bp
ATGTCACATTCAGTAAAAATTTATGATACTTGTATAGGATGTACTCAATGTGTCCGAGCATGCCCTACAGACGTATTAGAAATGATACCTTGGGATGGATGTAAAGCTAAGCAAATAGCTTCTGCTCCAAGAACCGAGGACTGTGTTGGTTGTAAGAGATGTGAATCCGCCTGTCCAACGGATTTTTTGAGCGTTCGAGTTTATTTATGGCATGAAACAACTCGAAGTATGGGTCTAGCTTATTGA

Protein Analysis

81

Amino Acids

9.04

Weight (kDa)

6.68

Isoelectric Point (pI)

54.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Fer4 PF00037 6 - 26 3.3e-07 4Fe-4S binding domain
Fer4_21 PF14697 9 - 62 7.1e-11 4Fe-4S dicluster domain
Fer4_7 PF12838 10 - 61 1.6e-10 4Fe-4S dicluster domain
Fer4_9 PF13187 11 - 61 3.9e-07 4Fe-4S dicluster domain
Fer4 PF00037 45 - 63 1.1e-06 4Fe-4S binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020888)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG01060
rosa_chinensis RchiOBHm_Chr5g0017221 RchiOBHm_Chr5g0043041 RchiOBHm_CPg0502781
rosa_wichuraiana Rw7G038430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 168
AcsI RAATTY 1 cut(s) 18
AfaI GTAC 1 cut(s) 43
AfiI CCNNNNNNNGG 1 cut(s) 95
AluBI AGCT 3 cut(s) 107, 119, 239
AluI AGCT 3 cut(s) 107, 119, 239
ApoI RAATTY 1 cut(s) 18
ArsI GACNNNNNNTTYG 1 cut(s) 217
BccI CCATC 1 cut(s) 89
BfaI CTAG 1 cut(s) 236
BfmI CTRYAG 1 cut(s) 66
BlpI GCTNAGC 1 cut(s) 108
Bpu1102I GCTNAGC 1 cut(s) 108
BsaBI GATNNNNATC 1 cut(s) 163
BsaJI CCNNGG 2 cut(s) 89, 135
Bsc4I CCNNNNNNNGG 1 cut(s) 95
Bse8I GATNNNNATC 1 cut(s) 163
BseDI CCNNGG 2 cut(s) 89, 135
BseGI GGATG 3 cut(s) 44, 100, 104
BseJI GATNNNNATC 1 cut(s) 163
BseLI CCNNNNNNNGG 1 cut(s) 95
BslI CCNNNNNNNGG 1 cut(s) 95
Bsp1720I GCTNAGC 1 cut(s) 108
BspACI CCGC 1 cut(s) 168
BssECI CCNNGG 2 cut(s) 89, 135
BssT1I CCWWGG 1 cut(s) 89
Bst4CI ACNGT 1 cut(s) 143
BstC8I GCNNGC 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 108
BstF5I GGATG 3 cut(s) 44, 100, 104
BstNSI RCATGY 1 cut(s) 63
BstSFI CTRYAG 1 cut(s) 66
BtsCI GGATG 3 cut(s) 44, 100, 104
Cac8I GCNNGC 1 cut(s) 61
Csp6I GTAC 1 cut(s) 42
CviAII CATG 2 cut(s) 60, 212
CviJI RGCY 3 cut(s) 107, 119, 239
CviKI_1 RGCY 3 cut(s) 107, 119, 239
CviQI GTAC 1 cut(s) 42
DdeI CTNAG 1 cut(s) 108
EciI GGCGGA 1 cut(s) 157
Eco130I CCWWGG 1 cut(s) 89
EcoT14I CCWWGG 1 cut(s) 89
ErhI CCWWGG 1 cut(s) 89
FaeI CATG 2 cut(s) 63, 215
FaiI YATR 6 cut(s) 24, 35, 61, 208, 213, 230
FatI CATG 2 cut(s) 59, 211
FokI GGATG 3 cut(s) 51, 107, 111
FspBI CTAG 1 cut(s) 236
Hin1II CATG 2 cut(s) 63, 215
HinfI GANTC 1 cut(s) 164
Hpy188I TCNGA 1 cut(s) 56
HpyCH4III ACNGT 1 cut(s) 143
HpyCH4IV ACGT 1 cut(s) 72
HpyF3I CTNAG 1 cut(s) 108
HpySE526I ACGT 1 cut(s) 72
Hsp92II CATG 2 cut(s) 63, 215
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 1 cut(s) 184
MaeI CTAG 1 cut(s) 236
MaeII ACGT 1 cut(s) 72
MaeIII GTNAC 1 cut(s) 3
MluCI AATT 1 cut(s) 18
MmeI TCCRAC 1 cut(s) 200
MnlI CCTC 1 cut(s) 130
NlaIII CATG 2 cut(s) 63, 215
NmuCI GTSAC 1 cut(s) 3
NspI RCATGY 1 cut(s) 63
PaeI GCATGC 1 cut(s) 63
PfeI GAWTC 1 cut(s) 164
RsaI GTAC 1 cut(s) 43
RsaNI GTAC 1 cut(s) 42
SetI ASST 5 cut(s) 75, 91, 109, 121, 241
SfcI CTRYAG 1 cut(s) 66
SphI GCATGC 1 cut(s) 63
Sse9I AATT 1 cut(s) 18
SsiI CCGC 1 cut(s) 168
SspMI CTAG 1 cut(s) 236
StyI CCWWGG 1 cut(s) 89
TaaI ACNGT 1 cut(s) 143
TaiI ACGT 1 cut(s) 75
TaqI TCGA 2 cut(s) 196, 223
TasI AATT 1 cut(s) 18
TatI WGTACW 1 cut(s) 41
TfiI GAWTC 1 cut(s) 164
TseFI GTSAC 1 cut(s) 3
Tsp45I GTSAC 1 cut(s) 3
TspDTI ATGAA 1 cut(s) 228
TspGWI ACGGA 1 cut(s) 194
XapI RAATTY 1 cut(s) 18
XceI RCATGY 1 cut(s) 63
XspI CTAG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.