MD00G1001700.v1.1

Component of the replication protein A complex (RPA) required for DNA recombination, repair and replication. The activity of RPA is mediated by single-stranded DNA binding and protein interactions. Probably involved in repair of double-strand DNA breaks (DSBs) induced by genotoxic stresses

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
383689 .. 385019
1331 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1001700.v1.1.491

Sequence Viewer

Length: 546 bp
ATGTTGTTACAATATCATAATTTCCATTTCAGGCCAATAAATCTTGTTGAAGGCTTGGAGAGCAACTCTATTGTGGATGTAATAGTGCTTGCTGTAAAAGGTGGTAGAGTCAATGATTTCAATGGGAAGGTGATGGGGACCATTTCTACAAGTCAGCTTCTAATAGAGCCTAATATTGAGAAGGCTTATGAGGTGAGGAATTGGTTTGAGAAAGAAGGAAATAATACCCCATGTATCTTTATTTCCAGGGAAACGACAGGTGTGGGTAGAGCAGATATCCGAAAGACTCTATCCCAAATTAAAGATGAGAAGCTAGGGACTTTCGAGAAGCTAGATTGGATCACAGTTGGTGCAAGGATTTCATTTATATATACTCAAGTTACAGATACAAGACTATACTGGCTCAACATGGGTAACTTCATTTTCAAGTTGAAAGTAAAGGAGGAGATTTTTAGTGATGAACAACATGTAAAATCAACAGTTATCAAAGCAGAGAAGGTGAACTTTTCATCGGAGGCTGGAGTTCATTTTACAATTGATAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

182

Amino Acids

20.76

Weight (kDa)

6.92

Isoelectric Point (pI)

12.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028737)

Species Orthologous Gene IDs
malus_domestica MD00G1001700.v1.1
pyrus_communis pycom16g25470

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 347
AflIII ACRYGT 1 cut(s) 466
AgsI TTSAA 4 cut(s) 50, 121, 427, 433
AjnI CCWGG 1 cut(s) 245
AluBI AGCT 3 cut(s) 157, 313, 331
AluI AGCT 3 cut(s) 157, 313, 331
AlwI GGATC 1 cut(s) 347
AoxI GGCC 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 138
AsuHPI GGTGA 3 cut(s) 142, 205, 511
AvaII GGWCC 1 cut(s) 138
BccI CCATC 1 cut(s) 127
BciT130I CCWGG 1 cut(s) 247
BfaI CTAG 2 cut(s) 314, 332
Bme1390I CCNGG 1 cut(s) 247
Bme18I GGWCC 1 cut(s) 138
BmgT120I GGNCC 1 cut(s) 138
BmiI GGNNCC 1 cut(s) 139
BmrFI CCNGG 1 cut(s) 247
BplI GAGNNNNNCTC 2 cut(s) 50, 82
BpmI CTGGAG 1 cut(s) 540
BpuEI CTTGAG 1 cut(s) 360
BsaJI CCNNGG 1 cut(s) 246
Bse1I ACTGG 1 cut(s) 404
BseBI CCWGG 1 cut(s) 247
BseDI CCNNGG 1 cut(s) 246
BseGI GGATG 1 cut(s) 82
BseNI ACTGG 1 cut(s) 404
BseRI GAGGAG 1 cut(s) 458
BshFI GGCC 1 cut(s) 34
BslFI GGGAC 2 cut(s) 151, 331
BsmFI GGGAC 2 cut(s) 151, 331
BsnI GGCC 1 cut(s) 34
Bsp143I GATC 1 cut(s) 339
BspANI GGCC 1 cut(s) 34
BspLI GGNNCC 1 cut(s) 139
BspPI GGATC 1 cut(s) 347
BsrI ACTGG 1 cut(s) 404
BssECI CCNNGG 1 cut(s) 246
BssMI GATC 1 cut(s) 339
Bst2UI CCWGG 1 cut(s) 247
Bst4CI ACNGT 2 cut(s) 346, 481
BstC8I GCNNGC 1 cut(s) 90
BstF5I GGATG 1 cut(s) 82
BstKTI GATC 1 cut(s) 342
BstMBI GATC 1 cut(s) 339
BstMWI GCNNNNNNNGC 1 cut(s) 60
BstNI CCWGG 1 cut(s) 247
BstNSI RCATGY 1 cut(s) 470
BstSCI CCNGG 1 cut(s) 245
BsuRI GGCC 1 cut(s) 34
BtsCI GGATG 1 cut(s) 82
Cac8I GCNNGC 1 cut(s) 90
Cfr13I GGNCC 1 cut(s) 138
CviAII CATG 3 cut(s) 231, 409, 467
CviJI RGCY 9 cut(s) 34, 54, 157, 169, 185, 313, 331, 403, 518
CviKI_1 RGCY 9 cut(s) 34, 54, 157, 169, 185, 313, 331, 403, 518
DpnI GATC 1 cut(s) 341
DpnII GATC 1 cut(s) 339
Eco32I GATATC 1 cut(s) 277
Eco47I GGWCC 1 cut(s) 138
EcoRII CCWGG 1 cut(s) 245
EcoRV GATATC 1 cut(s) 277
FaeI CATG 3 cut(s) 234, 412, 470
FaiI YATR 9 cut(s) 18, 189, 232, 368, 370, 372, 397, 410, 468
FalI AAGNNNNNCTT 2 cut(s) 488, 520
FaqI GGGAC 2 cut(s) 151, 331
FatI CATG 3 cut(s) 230, 408, 466
FokI GGATG 1 cut(s) 89
FspBI CTAG 2 cut(s) 314, 332
GsuI CTGGAG 1 cut(s) 540
HaeIII GGCC 1 cut(s) 34
Hin1II CATG 3 cut(s) 234, 412, 470
HinfI GANTC 2 cut(s) 108, 286
HphI GGTGA 3 cut(s) 142, 205, 511
Hpy166II GTNNAC 1 cut(s) 502
Hpy188I TCNGA 2 cut(s) 281, 514
Hpy188III TCNNGA 1 cut(s) 325
Hpy8I GTNNAC 1 cut(s) 502
HpyAV CCTTC 5 cut(s) 44, 121, 175, 209, 490
HpyCH4III ACNGT 2 cut(s) 346, 481
HpyCH4V TGCA 1 cut(s) 353
HpyF10VI GCNNNNNNNGC 1 cut(s) 60
Hsp92II CATG 3 cut(s) 234, 412, 470
Kzo9I GATC 1 cut(s) 339
LpnPI CCDG 6 cut(s) 16, 232, 243, 259, 385, 504
MaeI CTAG 2 cut(s) 314, 332
MaeIII GTNAC 3 cut(s) 6, 379, 413
MalI GATC 1 cut(s) 341
MboI GATC 1 cut(s) 339
MfeI CAATTG 1 cut(s) 534
MluCI AATT 4 cut(s) 19, 199, 297, 534
MlyI GAGTC 2 cut(s) 117, 280
MnlI CCTC 4 cut(s) 184, 189, 436, 508
MseI TTAA 1 cut(s) 300
MspR9I CCNGG 1 cut(s) 247
MunI CAATTG 1 cut(s) 534
MvaI CCWGG 1 cut(s) 247
MwoI GCNNNNNNNGC 1 cut(s) 60
NdeII GATC 1 cut(s) 339
NlaIII CATG 3 cut(s) 234, 412, 470
NlaIV GGNNCC 1 cut(s) 139
NspI RCATGY 1 cut(s) 470
PciI ACATGT 1 cut(s) 466
PleI GAGTC 2 cut(s) 116, 280
PpsI GAGTC 2 cut(s) 116, 280
PscI ACATGT 1 cut(s) 466
Psp6I CCWGG 1 cut(s) 245
PspGI CCWGG 1 cut(s) 245
PspN4I GGNNCC 1 cut(s) 139
PspPI GGNCC 1 cut(s) 138
SaqAI TTAA 1 cut(s) 300
Sau3AI GATC 1 cut(s) 339
Sau96I GGNCC 1 cut(s) 138
SchI GAGTC 2 cut(s) 117, 280
ScrFI CCNGG 1 cut(s) 247
SetI ASST 8 cut(s) 103, 132, 159, 195, 262, 315, 333, 501
SinI GGWCC 1 cut(s) 138
SmlI CTYRAG 1 cut(s) 375
SmoI CTYRAG 1 cut(s) 375
Sse9I AATT 4 cut(s) 19, 199, 297, 534
SspI AATATT 1 cut(s) 175
SspMI CTAG 2 cut(s) 314, 332
StyD4I CCNGG 1 cut(s) 245
TaaI ACNGT 2 cut(s) 346, 481
TaqI TCGA 1 cut(s) 324
TasI AATT 4 cut(s) 19, 199, 297, 534
Tru1I TTAA 1 cut(s) 300
Tru9I TTAA 1 cut(s) 300
TspDTI ATGAA 5 cut(s) 351, 409, 474, 498, 515
VpaK11BI GGWCC 1 cut(s) 138
XceI RCATGY 1 cut(s) 470
XspI CTAG 2 cut(s) 314, 332
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.