Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr00

Orthogroup ID

OG0028750

Physical Location & Seq

Genomic Coordinates Forward (+)

2938220 .. 2938974

Gene Structure 755 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD00G1018200.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 150 bp

ATGGCTTGGAGATTAGCTAACAGCAAGCAACCTTTCTTGTATGTCATTAGATCTGGCTCAATTTGTGGTTCCGATTGGATTGACCTATTGCCTCAAGGTTTTGCTGAAGCTATAGGAGAAAGAGGTGTTAGACTTAATATGTTCATGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0047254 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

ko00140 ko00380 ko00402 ko00830 ko00908 ko00980 ko01100 ko01110 ko04913 ko05204 map00140 map00380 map00402 map00830 map00908 map00980 map01100 map01110 map04913 map05204

Pfam Domains

Protein Families

UDPGT

Protein Analysis

50

Amino Acids

5.55

Weight (kDa)

7.95

Isoelectric Point (pI)

38.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0028750)

Species	Orthologous Gene IDs
malus_domestica	MD00G1018200.v1.1
pyrus_communis	pycom14g08190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	126
AluBI	AGCT	2 cut(s)	17, 110
AluI	AGCT	2 cut(s)	17, 110
BfmI	CTRYAG	1 cut(s)	111
BglII	AGATCT	1 cut(s)	50
BmiI	GGNNCC	1 cut(s)	70
BpuEI	CTTGAG	1 cut(s)	78
Bsp143I	GATC	1 cut(s)	50
BspLI	GGNNCC	1 cut(s)	70
BssMI	GATC	1 cut(s)	50
BstC8I	GCNNGC	1 cut(s)	26
BstKTI	GATC	1 cut(s)	53
BstMBI	GATC	1 cut(s)	50
BstSFI	CTRYAG	1 cut(s)	111
BstX2I	RGATCY	1 cut(s)	50
BstYI	RGATCY	1 cut(s)	50
Cac8I	GCNNGC	1 cut(s)	26
CviAII	CATG	1 cut(s)	145
CviJI	RGCY	4 cut(s)	5, 17, 57, 110
CviKI_1	RGCY	4 cut(s)	5, 17, 57, 110
DpnI	GATC	1 cut(s)	52
DpnII	GATC	1 cut(s)	50
Eco57I	CTGAAG	1 cut(s)	126
FaeI	CATG	1 cut(s)	148
FaiI	YATR	4 cut(s)	42, 113, 140, 146
FatI	CATG	1 cut(s)	144
Hin1II	CATG	1 cut(s)	148
Hpy188I	TCNGA	1 cut(s)	73
Hsp92II	CATG	1 cut(s)	148
Kzo9I	GATC	1 cut(s)	50
LpnPI	CCDG	1 cut(s)	39
MalI	GATC	1 cut(s)	52
MboI	GATC	1 cut(s)	50
MflI	RGATCY	1 cut(s)	50
MluCI	AATT	1 cut(s)	60
MnlI	CCTC	2 cut(s)	102, 116
MseI	TTAA	1 cut(s)	135
NdeII	GATC	1 cut(s)	50
NlaIII	CATG	1 cut(s)	148
NlaIV	GGNNCC	1 cut(s)	70
PspN4I	GGNNCC	1 cut(s)	70
PsuI	RGATCY	1 cut(s)	50
SaqAI	TTAA	1 cut(s)	135
Sau3AI	GATC	1 cut(s)	50
SetI	ASST	6 cut(s)	19, 34, 87, 100, 112, 127
SfcI	CTRYAG	1 cut(s)	111
SgeI	CNNG	5 cut(s)	18, 37, 49, 66, 107
SmlI	CTYRAG	1 cut(s)	93
SmoI	CTYRAG	1 cut(s)	93
Sse9I	AATT	1 cut(s)	60
TasI	AATT	1 cut(s)	60
Tru1I	TTAA	1 cut(s)	135
Tru9I	TTAA	1 cut(s)	135
TspDTI	ATGAA	1 cut(s)	133

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.