MD04G1092900.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Forward (+)
16602785 .. 16603977
1193 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1092900.v1.1.491

Sequence Viewer

Length: 294 bp
ATGGAACAAAAGAAAAGATCTATTCTTGGAGATCACAGATCCGAACAAACAGCAGGACACTTGAATCCGATGTATAGCCGAGAGAAAGGAAATGTTGAAGTTGCAGATCCAAAGGCAAACAAATTATCAACTGGCACATCGTCGGATTTTGAAAGGGAACCCACATTCTGGAAGCTTGACAAAAGCAAACCAAATGAAGATGAGTCCGGTCATCACAGATCCCTACGGCAACTGCAACGGACGAATCATGGCAAAAGCTTCCACGAACCCCAGATATGTGCATCTGGGAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

11.09

Weight (kDa)

9.2

Isoelectric Point (pI)

49.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028699)

Species Orthologous Gene IDs
malus_domestica MD04G1092900.v1.1
pyrus_communis pycom10g16290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 168
AclWI GGATC 3 cut(s) 33, 101, 213
AfiI CCNNNNNNNGG 1 cut(s) 168
AgsI TTSAA 3 cut(s) 64, 98, 152
AluBI AGCT 2 cut(s) 175, 258
AluI AGCT 2 cut(s) 175, 258
AlwI GGATC 3 cut(s) 33, 101, 213
BceAI ACGGC 1 cut(s) 242
BglII AGATCT 1 cut(s) 17
BmiI GGNNCC 1 cut(s) 159
BmsI GCATC 1 cut(s) 290
BsaWI WCCGGW 1 cut(s) 206
Bsc4I CCNNNNNNNGG 1 cut(s) 168
Bse1I ACTGG 1 cut(s) 136
BseLI CCNNNNNNNGG 1 cut(s) 168
BseNI ACTGG 1 cut(s) 136
BsiSI CCGG 1 cut(s) 207
BslI CCNNNNNNNGG 1 cut(s) 168
Bsp143I GATC 5 cut(s) 17, 31, 38, 106, 218
BspLI GGNNCC 1 cut(s) 159
BspPI GGATC 3 cut(s) 33, 101, 213
BsrI ACTGG 1 cut(s) 136
BssMI GATC 5 cut(s) 17, 31, 38, 106, 218
BstKTI GATC 5 cut(s) 20, 34, 41, 109, 221
BstMBI GATC 5 cut(s) 17, 31, 38, 106, 218
BstX2I RGATCY 4 cut(s) 17, 38, 106, 218
BstYI RGATCY 4 cut(s) 17, 38, 106, 218
CviAII CATG 1 cut(s) 248
CviJI RGCY 3 cut(s) 78, 175, 258
CviKI_1 RGCY 3 cut(s) 78, 175, 258
DpnI GATC 5 cut(s) 19, 33, 40, 108, 220
DpnII GATC 5 cut(s) 17, 31, 38, 106, 218
FaeI CATG 1 cut(s) 251
FaiI YATR 3 cut(s) 75, 249, 277
FatI CATG 1 cut(s) 247
HapII CCGG 1 cut(s) 207
Hin1II CATG 1 cut(s) 251
HindIII AAGCTT 2 cut(s) 173, 256
HinfI GANTC 3 cut(s) 64, 203, 244
HpaII CCGG 1 cut(s) 207
Hpy188I TCNGA 3 cut(s) 43, 69, 145
Hpy188III TCNNGA 1 cut(s) 169
Hpy99I CGWCG 1 cut(s) 145
HpyCH4V TGCA 3 cut(s) 104, 235, 281
Hsp92II CATG 1 cut(s) 251
Kzo9I GATC 5 cut(s) 17, 31, 38, 106, 218
LpnPI CCDG 6 cut(s) 39, 117, 154, 220, 270, 284
LweI GCATC 1 cut(s) 290
MalI GATC 5 cut(s) 19, 33, 40, 108, 220
MboI GATC 5 cut(s) 17, 31, 38, 106, 218
MboII GAAGA 1 cut(s) 209
MflI RGATCY 4 cut(s) 17, 38, 106, 218
MluCI AATT 1 cut(s) 122
MlyI GAGTC 1 cut(s) 212
MmeI TCCRAC 1 cut(s) 123
MnlI CCTC 1 cut(s) 282
MspI CCGG 1 cut(s) 207
NdeII GATC 5 cut(s) 17, 31, 38, 106, 218
NlaIII CATG 1 cut(s) 251
NlaIV GGNNCC 1 cut(s) 159
NmeAIII GCCGAG 1 cut(s) 104
PfeI GAWTC 2 cut(s) 64, 244
PflMI CCANNNNNTGG 1 cut(s) 168
PleI GAGTC 1 cut(s) 211
PpsI GAGTC 1 cut(s) 211
PspN4I GGNNCC 1 cut(s) 159
PsuI RGATCY 4 cut(s) 17, 38, 106, 218
Sau3AI GATC 5 cut(s) 17, 31, 38, 106, 218
SchI GAGTC 1 cut(s) 212
SetI ASST 3 cut(s) 177, 260, 293
SfaNI GCATC 1 cut(s) 290
Sse9I AATT 1 cut(s) 122
TasI AATT 1 cut(s) 122
TfiI GAWTC 2 cut(s) 64, 244
TspDTI ATGAA 1 cut(s) 210
TspGWI ACGGA 1 cut(s) 253
Van91I CCANNNNNTGG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.