Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr05

Orthogroup ID

OG0028818

Physical Location & Seq

Genomic Coordinates Reverse (-)

18069118 .. 18074634

Gene Structure 5517 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD05G1085900.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 141 bp

ATGTGCTATTGCAAGGGTATTCGAGATAAGGGTGGAGGCTCAAAATTCAGGTATATGGTTACTCTGAATATTCATTTTTCTTGTATGAATGCATCTGGAGATTCTATTGAATGTAGCCGAGATGGAATATTTGAGGTTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006807 GO:0008150 GO:0008152 GO:0009314 GO:0009416 GO:0009605 GO:0009606 GO:0009628 GO:0009637 GO:0009638 GO:0009987 GO:0016020 GO:0016567 GO:0019538 GO:0032446 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0050896 GO:0070647 GO:0071704 GO:0071944 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BTB NPH3

Protein Analysis

47

Amino Acids

5.13

Weight (kDa)

7.67

Isoelectric Point (pI)

63.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0028818)

Species	Orthologous Gene IDs
malus_domestica	MD05G1085900.v1.1
pyrus_communis	pycom03g10510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	44
AgsI	TTSAA	1 cut(s)	110
ApoI	RAATTY	1 cut(s)	44
BccI	CCATC	1 cut(s)	116
BmsI	GCATC	1 cut(s)	101
BpmI	CTGGAG	1 cut(s)	117
BsmI	GAATGC	1 cut(s)	94
CviJI	RGCY	2 cut(s)	39, 117
CviKI_1	RGCY	2 cut(s)	39, 117
EcoT22I	ATGCAT	1 cut(s)	94
FaiI	YATR	3 cut(s)	54, 56, 86
GsuI	CTGGAG	1 cut(s)	117
HinfI	GANTC	1 cut(s)	101
Hpy188I	TCNGA	1 cut(s)	66
Hpy188III	TCNNGA	2 cut(s)	23, 96
HpyCH4V	TGCA	2 cut(s)	12, 92
LpnPI	CCDG	2 cut(s)	34, 81
LweI	GCATC	1 cut(s)	101
MaeIII	GTNAC	1 cut(s)	58
MluCI	AATT	1 cut(s)	44
MnlI	CCTC	2 cut(s)	29, 127
Mph1103I	ATGCAT	1 cut(s)	94
Mva1269I	GAATGC	1 cut(s)	94
NsiI	ATGCAT	1 cut(s)	94
PctI	GAATGC	1 cut(s)	94
PfeI	GAWTC	1 cut(s)	101
SetI	ASST	2 cut(s)	53, 138
SfaNI	GCATC	1 cut(s)	101
SgeI	CNNG	6 cut(s)	25, 35, 61, 93, 108, 131
Sse9I	AATT	1 cut(s)	44
SspI	AATATT	2 cut(s)	70, 129
TaqI	TCGA	1 cut(s)	22
TasI	AATT	1 cut(s)	44
TfiI	GAWTC	1 cut(s)	101
TspDTI	ATGAA	2 cut(s)	62, 101
XapI	RAATTY	1 cut(s)	44
Zsp2I	ATGCAT	1 cut(s)	94

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.