MD08G1197600.v1.1

At1g04910-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Forward (+)
25621882 .. 25622237
356 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1197600.v1.1.491

Sequence Viewer

Length: 192 bp
ATGAACTTGAAGACTATTAGACCAAACATGGCGTTGTCGGGCAAACTTTTCGTGAATAAGAGCATGGAATGGTCGGATTTCCAACGTGCGCCTTCAGATGGGCACAAAACTAGACAGGGGCAGATGAGGCTGAGGAAGGACAAACAATCGATATACACGTACCCTGCTCCTGATTGCATGTGTCGAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.34

Weight (kDa)

10.02

Isoelectric Point (pI)

45.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024399)

Species Orthologous Gene IDs
malus_domestica MD08G1197600.v1.1
pyrus_communis pycom08g16990 pycom15g34520

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 78
AfaI GTAC 1 cut(s) 161
AfiI CCNNNNNNNGG 1 cut(s) 98
AflIII ACRYGT 1 cut(s) 156
AgsI TTSAA 1 cut(s) 10
AluBI AGCT 1 cut(s) 188
AluI AGCT 1 cut(s) 188
AspLEI GCGC 1 cut(s) 91
BaeGI GKGCMC 1 cut(s) 105
BbsI GAAGAC 1 cut(s) 17
BbvCI CCTCAGC 1 cut(s) 131
BccI CCATC 1 cut(s) 92
BcgI CGANNNNNNTGC 2 cut(s) 31, 65
BfaI CTAG 1 cut(s) 111
BpiI GAAGAC 1 cut(s) 17
Bpu10I CCTNAGC 1 cut(s) 131
Bsa29I ATCGAT 1 cut(s) 149
BsaAI YACGTR 1 cut(s) 159
Bsc4I CCNNNNNNNGG 1 cut(s) 98
BseCI ATCGAT 1 cut(s) 149
BseLI CCNNNNNNNGG 1 cut(s) 98
BseMII CTCAG 1 cut(s) 122
BseSI GKGCMC 1 cut(s) 105
BshVI ATCGAT 1 cut(s) 149
BslI CCNNNNNNNGG 1 cut(s) 98
Bsp1286I GDGCHC 1 cut(s) 105
BspCNI CTCAG 1 cut(s) 123
BspDI ATCGAT 1 cut(s) 149
BstBAI YACGTR 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 131
BstHHI GCGC 1 cut(s) 91
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstNSI RCATGY 1 cut(s) 181
BstSLI GKGCMC 1 cut(s) 105
BstV2I GAAGAC 1 cut(s) 17
Bsu15I ATCGAT 1 cut(s) 149
BsuTUI ATCGAT 1 cut(s) 149
CfoI GCGC 1 cut(s) 91
ClaI ATCGAT 1 cut(s) 149
Csp6I GTAC 1 cut(s) 160
CviAII CATG 3 cut(s) 28, 64, 178
CviJI RGCY 2 cut(s) 130, 188
CviKI_1 RGCY 2 cut(s) 130, 188
CviQI GTAC 1 cut(s) 160
DdeI CTNAG 1 cut(s) 131
Eco57I CTGAAG 1 cut(s) 78
FaeI CATG 3 cut(s) 31, 67, 181
FaiI YATR 4 cut(s) 29, 65, 154, 179
FatI CATG 3 cut(s) 27, 63, 177
FspBI CTAG 1 cut(s) 111
GlaI GCGC 1 cut(s) 90
HhaI GCGC 1 cut(s) 91
Hin1II CATG 3 cut(s) 31, 67, 181
Hin6I GCGC 1 cut(s) 89
HinP1I GCGC 1 cut(s) 89
Hpy188I TCNGA 2 cut(s) 76, 97
Hpy188III TCNNGA 2 cut(s) 52, 170
HpyAV CCTTC 2 cut(s) 102, 130
HpyCH4IV ACGT 2 cut(s) 85, 158
HpyCH4V TGCA 1 cut(s) 177
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
HpyF3I CTNAG 1 cut(s) 131
HpySE526I ACGT 2 cut(s) 85, 158
Hsp92II CATG 3 cut(s) 31, 67, 181
HspAI GCGC 1 cut(s) 89
LmnI GCTCC 1 cut(s) 172
LpnPI CCDG 3 cut(s) 101, 177, 183
MaeI CTAG 1 cut(s) 111
MaeII ACGT 2 cut(s) 85, 158
MboII GAAGA 1 cut(s) 22
MhlI GDGCHC 1 cut(s) 105
MmeI TCCRAC 2 cut(s) 54, 106
MnlI CCTC 2 cut(s) 120, 126
MseI TTAA 1 cut(s) 190
MwoI GCNNNNNNNGC 1 cut(s) 127
NlaIII CATG 3 cut(s) 31, 67, 181
NspI RCATGY 1 cut(s) 181
PcsI WCGNNNNNNNCGW 1 cut(s) 155
Ppu21I YACGTR 1 cut(s) 159
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
SaqAI TTAA 1 cut(s) 190
SduI GDGCHC 1 cut(s) 105
SetI ASST 3 cut(s) 88, 161, 190
SspMI CTAG 1 cut(s) 111
TaiI ACGT 2 cut(s) 88, 161
TaqI TCGA 2 cut(s) 149, 184
Tru1I TTAA 1 cut(s) 190
Tru9I TTAA 1 cut(s) 190
TspDTI ATGAA 1 cut(s) 17
XceI RCATGY 1 cut(s) 181
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.