MD09G1245300.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0022265
Physical Location & Seq
Reverse (-)
31306636 .. 31307317
682 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1245300.v1.1.491

Sequence Viewer

Length: 246 bp
ATGGATGGCGAGGACTTGAAAACTTGGATTGGTGCAAATAGATTATATCCAGGCGTTCCTGATGCTCTAAGATTTGCAAGCTCAACCATATACATAGTCACCACAAAACAGAGCCGATTCGCTGATGCTTTGCTGCGAGAACTTGCAGGAGTGACGATACCGCCTGAAAAGATATTTGGTCTTGGCAGTGGTCCAAAGGTAGAAGTATTGAAGCAAATTCAAAAGAAACCAGAACATCAGGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

8.95

Weight (kDa)

8.03

Isoelectric Point (pI)

30.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022265)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g14570
malus_domestica MD09G1245300.v1.1
rosa_laevigata RLG00000028109
rosa_multiflora Rmu_sc0003229.1_g000014

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 161
AcsI RAATTY 1 cut(s) 216
AgsI TTSAA 3 cut(s) 19, 211, 221
AjnI CCWGG 1 cut(s) 49
AjuI GAANNNNNNNTTGG 2 cut(s) 159, 191
AluBI AGCT 1 cut(s) 81
AluI AGCT 1 cut(s) 81
ApeKI GCWGC 1 cut(s) 133
ApoI RAATTY 1 cut(s) 216
AspS9I GGNCC 1 cut(s) 191
AsuHPI GGTGA 1 cut(s) 91
AvaII GGWCC 1 cut(s) 191
BbvI GCAGC 1 cut(s) 120
BciT130I CCWGG 1 cut(s) 51
BisI GCNGC 1 cut(s) 134
BlsI GCNGC 1 cut(s) 135
Bme1390I CCNGG 1 cut(s) 51
Bme18I GGWCC 1 cut(s) 191
BmgT120I GGNCC 1 cut(s) 191
BmrFI CCNGG 1 cut(s) 51
BmsI GCATC 2 cut(s) 52, 115
BseBI CCWGG 1 cut(s) 51
BseGI GGATG 1 cut(s) 10
BseXI GCAGC 1 cut(s) 120
BspACI CCGC 1 cut(s) 161
Bst2UI CCWGG 1 cut(s) 51
BstC8I GCNNGC 1 cut(s) 79
BstDEI CTNAG 1 cut(s) 68
BstF5I GGATG 1 cut(s) 10
BstNI CCWGG 1 cut(s) 51
BstSCI CCNGG 1 cut(s) 49
BstV1I GCAGC 1 cut(s) 120
BtsCI GGATG 1 cut(s) 10
BtsI GCAGTG 1 cut(s) 193
BtsIMutI CAGTG 1 cut(s) 193
Cac8I GCNNGC 1 cut(s) 79
Cfr13I GGNCC 1 cut(s) 191
CviJI RGCY 2 cut(s) 81, 114
CviKI_1 RGCY 2 cut(s) 81, 114
DdeI CTNAG 1 cut(s) 68
Eco47I GGWCC 1 cut(s) 191
EcoRII CCWGG 1 cut(s) 49
FaiI YATR 4 cut(s) 46, 89, 91, 95
Fnu4HI GCNGC 1 cut(s) 134
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 1 cut(s) 134
GluI GCNGC 1 cut(s) 134
HinfI GANTC 1 cut(s) 117
HphI GGTGA 1 cut(s) 91
Hpy188III TCNNGA 2 cut(s) 59, 239
HpyCH4V TGCA 3 cut(s) 35, 77, 146
HpyF3I CTNAG 1 cut(s) 68
LpnPI CCDG 6 cut(s) 36, 63, 72, 132, 177, 224
Lsp1109I GCAGC 1 cut(s) 120
LweI GCATC 2 cut(s) 52, 115
MaeIII GTNAC 2 cut(s) 97, 151
MluCI AATT 1 cut(s) 216
MnlI CCTC 1 cut(s) 4
MspR9I CCNGG 1 cut(s) 51
MvaI CCWGG 1 cut(s) 51
NmuCI GTSAC 2 cut(s) 97, 151
PfeI GAWTC 1 cut(s) 117
PkrI GCNGC 1 cut(s) 135
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
PspPI GGNCC 1 cut(s) 191
SatI GCNGC 1 cut(s) 134
Sau96I GGNCC 1 cut(s) 191
ScrFI CCNGG 1 cut(s) 51
SetI ASST 2 cut(s) 83, 201
SfaNI GCATC 2 cut(s) 52, 115
SinI GGWCC 1 cut(s) 191
Sse9I AATT 1 cut(s) 216
SsiI CCGC 1 cut(s) 161
StyD4I CCNGG 1 cut(s) 49
TasI AATT 1 cut(s) 216
TfiI GAWTC 1 cut(s) 117
TscAI CASTG 1 cut(s) 193
TseFI GTSAC 2 cut(s) 97, 151
TseI GCWGC 1 cut(s) 133
Tsp45I GTSAC 2 cut(s) 97, 151
TspRI CASTG 1 cut(s) 193
VpaK11BI GGWCC 1 cut(s) 191
XapI RAATTY 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.