MD10G1089600.v1.1

RNA polymerase Rpb1, domain 5

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0017882
Physical Location & Seq
Reverse (-)
13348985 .. 13349164
180 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1089600.v1.1.491

Sequence Viewer

Length: 180 bp
ATGGCACCTTATATCTTTGCAAATCGTAAAGGCATTCATATTATAAATCTTACTAGATCTGCTCAGTTTTTATCAAAAGCTTGTGATTTAGTTTTTGATTCAGCAAATAGGGGAAAACAATTCTTAATTGTTGGTACCAAAAATAAAGTAGCTGATTCAGTAGCACGGGTTGCAATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00190 ko00195 ko00230 ko00240 ko01100 ko03020 map00190 map00195 map00230 map00240 map01100 map03020
Pfam Domains
Protein Families
RNA_pol_Rpb1_3 RNA_pol_Rpb1_4 RNA_pol_Rpb1_5 Ribosomal_S2

Protein Analysis

60

Amino Acids

6.48

Weight (kDa)

10.29

Isoelectric Point (pI)

44.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S2 PF00318 1 - 58 3.3e-15 Ribosomal protein S2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 44
Acc65I GGTACC 1 cut(s) 134
AccB1I GGYRCC 2 cut(s) 4, 134
AfaI GTAC 1 cut(s) 136
AluBI AGCT 2 cut(s) 80, 152
AluI AGCT 2 cut(s) 80, 152
Asp718I GGTACC 1 cut(s) 134
BanI GGYRCC 2 cut(s) 4, 134
BfaI CTAG 1 cut(s) 54
BglII AGATCT 1 cut(s) 56
BmiI GGNNCC 2 cut(s) 6, 136
BseMII CTCAG 1 cut(s) 77
BshNI GGYRCC 2 cut(s) 4, 134
BsmI GAATGC 1 cut(s) 33
Bsp143I GATC 1 cut(s) 56
BspCNI CTCAG 1 cut(s) 76
BspLI GGNNCC 2 cut(s) 6, 136
BspT107I GGYRCC 2 cut(s) 4, 134
BssMI GATC 1 cut(s) 56
BstAPI GCANNNNNTGC 1 cut(s) 170
BstDEI CTNAG 1 cut(s) 63
BstKTI GATC 1 cut(s) 59
BstMBI GATC 1 cut(s) 56
BstMWI GCNNNNNNNGC 1 cut(s) 170
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
Csp6I GTAC 1 cut(s) 135
CviJI RGCY 2 cut(s) 80, 152
CviKI_1 RGCY 2 cut(s) 80, 152
CviQI GTAC 1 cut(s) 135
DdeI CTNAG 1 cut(s) 63
DpnI GATC 1 cut(s) 58
DpnII GATC 1 cut(s) 56
FaiI YATR 4 cut(s) 12, 39, 44, 178
FspBI CTAG 1 cut(s) 54
FspEI CC 9 cut(s) 15, 21, 94, 95, 96, 117, 151, 151, 152
HindIII AAGCTT 1 cut(s) 78
HinfI GANTC 2 cut(s) 98, 155
HpyCH4V TGCA 2 cut(s) 20, 173
HpyF10VI GCNNNNNNNGC 1 cut(s) 170
HpyF3I CTNAG 1 cut(s) 63
KpnI GGTACC 1 cut(s) 138
Kzo9I GATC 1 cut(s) 56
MaeI CTAG 1 cut(s) 54
MalI GATC 1 cut(s) 58
MboI GATC 1 cut(s) 56
MflI RGATCY 1 cut(s) 56
MluCI AATT 2 cut(s) 119, 126
MseI TTAA 1 cut(s) 125
Mva1269I GAATGC 1 cut(s) 33
MwoI GCNNNNNNNGC 1 cut(s) 170
NdeII GATC 1 cut(s) 56
NlaIV GGNNCC 2 cut(s) 6, 136
PctI GAATGC 1 cut(s) 33
PfeI GAWTC 2 cut(s) 98, 155
PsiI TTATAA 1 cut(s) 44
PspN4I GGNNCC 2 cut(s) 6, 136
PsuI RGATCY 1 cut(s) 56
RsaI GTAC 1 cut(s) 136
RsaNI GTAC 1 cut(s) 135
SaqAI TTAA 1 cut(s) 125
Sau3AI GATC 1 cut(s) 56
SetI ASST 3 cut(s) 10, 82, 154
SgeI CNNG 2 cut(s) 66, 93
Sse9I AATT 2 cut(s) 119, 126
SspMI CTAG 1 cut(s) 54
TasI AATT 2 cut(s) 119, 126
TfiI GAWTC 2 cut(s) 98, 155
Tru1I TTAA 1 cut(s) 125
Tru9I TTAA 1 cut(s) 125
TspDTI ATGAA 1 cut(s) 26
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.