MD10G1106800.v1.1
MYB Family

Telomere repeat-binding factor

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Reverse (-)
17524407 .. 17530297
5891 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1106800.v1.1.491

Sequence Viewer

Length: 699 bp
ATGTTGGGGACCAGTAATCTTTGTTGCATGGCTTATTTGTTTATTTGTAGTTTACAGCTGGACAATCTTATCATGGAAGCTATAACAAGGTTGAAGGAGCCTGGTGGATCTAATAAAACGACTATTGCTGCATATATAGAGGACGAATATTGGCCTCCTCAAGATTTCAAGAGGCTATTATCTGAGAAACTAAAATTCTTGACAGCAAGCCGTAAACTGATTAAGGTAAAACGCAGATACAGGATTGCACCTACCCCAGCGTTATCTGAAAAAAGAAGAAATACCTCGATGTATCCTTTTGAGGGAAGACAGGTTGCCTCTGCTTTTGAGGGAAGACGTATGGCATCTCCTTTTGAGGGAAGACGTATGGCATCTCCTTTTGAGGGAAGACCGATGGTGTCTCCTTTTGAGGGAAGATATATGGTGTCTCCAAAATTTGACAATGATGAGGCTACCATCATGATGAAAGCCCAAATTGATTGGGAGCTTGCGAAGATGAGGACTATGACCCCCAGGGAAGCTACTTTAGCTGCTGCTCAAGCAGTGAAAGAGGCGGAAGCTGCCATTGCTGAAGCTGAAGAGGCAGCTAGGGAAGCTGAGGCTGCTGAAGCTGATGCAGAAGCAGCACAAGCTTTTGCAGAAGCAGCAATGAAGACACTAAAAGGAAGAAATGCTGCGAAGACGATGAATCGTCCCTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

233

Amino Acids

25.98

Weight (kDa)

9.08

Isoelectric Point (pI)

52.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Linker_histone PF00538 20 - 77 1.1e-08 linker histone H1 and H5 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028209)

Species Orthologous Gene IDs
malus_domestica MD10G1106800.v1.1
pyrus_communis pycom10g09220

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 554
AclWI GGATC 1 cut(s) 115
AcsI RAATTY 2 cut(s) 194, 434
AcuI CTGAAG 3 cut(s) 591, 597, 627
AfiI CCNNNNNNNGG 4 cut(s) 302, 356, 383, 410
AgsI TTSAA 2 cut(s) 94, 169
AjnI CCWGG 2 cut(s) 100, 512
Alw26I GTCTC 2 cut(s) 405, 432
AlwI GGATC 1 cut(s) 115
AoxI GGCC 1 cut(s) 152
ApeKI GCWGC 9 cut(s) 128, 530, 533, 560, 584, 602, 623, 644, 674
ApoI RAATTY 2 cut(s) 194, 434
AspS9I GGNCC 1 cut(s) 9
AvaII GGWCC 1 cut(s) 9
BbsI GAAGAC 6 cut(s) 313, 340, 367, 394, 659, 686
BbvCI CCTCAGC 1 cut(s) 597
BbvI GCAGC 9 cut(s) 115, 517, 520, 547, 589, 596, 635, 656, 661
BccI CCATC 2 cut(s) 388, 464
BceAI ACGGC 1 cut(s) 195
BciT130I CCWGG 2 cut(s) 102, 514
BciVI GTATCC 1 cut(s) 303
BcoDI GTCTC 2 cut(s) 405, 432
BfaI CTAG 1 cut(s) 588
BfuI GTATCC 1 cut(s) 303
BisI GCNGC 9 cut(s) 129, 531, 534, 561, 585, 603, 624, 645, 675
BlsI GCNGC 9 cut(s) 130, 532, 535, 562, 586, 604, 625, 646, 676
Bme1390I CCNGG 2 cut(s) 102, 514
Bme18I GGWCC 1 cut(s) 9
BmgT120I GGNCC 1 cut(s) 9
BmiI GGNNCC 2 cut(s) 10, 99
BmrFI CCNGG 2 cut(s) 102, 514
BmsI GCATC 3 cut(s) 353, 380, 604
BpiI GAAGAC 6 cut(s) 313, 340, 367, 394, 659, 686
Bpu10I CCTNAGC 1 cut(s) 597
BpuEI CTTGAG 2 cut(s) 144, 522
BsaJI CCNNGG 2 cut(s) 512, 513
Bsc4I CCNNNNNNNGG 4 cut(s) 302, 356, 383, 410
Bse1I ACTGG 1 cut(s) 12
Bse3DI GCAATG 2 cut(s) 564, 654
BseBI CCWGG 2 cut(s) 102, 514
BseDI CCNNGG 2 cut(s) 512, 513
BseLI CCNNNNNNNGG 4 cut(s) 302, 356, 383, 410
BseMI GCAATG 2 cut(s) 564, 654
BseMII CTCAG 2 cut(s) 174, 588
BseNI ACTGG 1 cut(s) 12
BseRI GAGGAG 1 cut(s) 147
BseXI GCAGC 9 cut(s) 115, 517, 520, 547, 589, 596, 635, 656, 661
BseYI CCCAGC 1 cut(s) 256
BshFI GGCC 1 cut(s) 154
BslFI GGGAC 2 cut(s) 22, 678
BslI CCNNNNNNNGG 4 cut(s) 302, 356, 383, 410
BsmAI GTCTC 2 cut(s) 405, 432
BsmFI GGGAC 2 cut(s) 22, 678
BsnI GGCC 1 cut(s) 154
Bsp143I GATC 1 cut(s) 107
BspACI CCGC 1 cut(s) 554
BspANI GGCC 1 cut(s) 154
BspCNI CTCAG 2 cut(s) 175, 589
BspHI TCATGA 1 cut(s) 459
BspLI GGNNCC 2 cut(s) 10, 99
BspPI GGATC 1 cut(s) 115
BsrDI GCAATG 2 cut(s) 564, 654
BsrI ACTGG 1 cut(s) 12
BssECI CCNNGG 2 cut(s) 512, 513
BssMI GATC 1 cut(s) 107
Bst2UI CCWGG 2 cut(s) 102, 514
Bst6I CTCTTC 1 cut(s) 573
BstC8I GCNNGC 2 cut(s) 208, 489
BstDEI CTNAG 2 cut(s) 183, 597
BstKTI GATC 1 cut(s) 110
BstMAI GTCTC 2 cut(s) 405, 432
BstMBI GATC 1 cut(s) 107
BstNI CCWGG 2 cut(s) 102, 514
BstSCI CCNGG 2 cut(s) 100, 512
BstV1I GCAGC 9 cut(s) 115, 517, 520, 547, 589, 596, 635, 656, 661
BstV2I GAAGAC 6 cut(s) 313, 340, 367, 394, 659, 686
BstX2I RGATCY 1 cut(s) 107
BstYI RGATCY 1 cut(s) 107
BsuI GTATCC 1 cut(s) 303
BsuRI GGCC 1 cut(s) 154
BtsI GCAGTG 1 cut(s) 549
BtsIMutI CAGTG 1 cut(s) 549
Cac8I GCNNGC 2 cut(s) 208, 489
CciI TCATGA 1 cut(s) 459
Cfr13I GGNCC 1 cut(s) 9
CviAII CATG 3 cut(s) 28, 73, 460
DdeI CTNAG 2 cut(s) 183, 597
DpnI GATC 1 cut(s) 109
DpnII GATC 1 cut(s) 107
Eam1104I CTCTTC 1 cut(s) 573
EarI CTCTTC 1 cut(s) 573
EciI GGCGGA 1 cut(s) 569
Eco47I GGWCC 1 cut(s) 9
Eco57I CTGAAG 3 cut(s) 591, 597, 627
EcoRII CCWGG 2 cut(s) 100, 512
FaeI CATG 3 cut(s) 31, 76, 463
FaqI GGGAC 2 cut(s) 22, 678
FatI CATG 3 cut(s) 27, 72, 459
Fnu4HI GCNGC 9 cut(s) 129, 531, 534, 561, 585, 603, 624, 645, 675
Fsp4HI GCNGC 9 cut(s) 129, 531, 534, 561, 585, 603, 624, 645, 675
FspBI CTAG 1 cut(s) 588
GluI GCNGC 9 cut(s) 129, 531, 534, 561, 585, 603, 624, 645, 675
GsaI CCCAGC 1 cut(s) 260
HaeIII GGCC 1 cut(s) 154
Hin1II CATG 3 cut(s) 31, 76, 463
HindIII AAGCTT 1 cut(s) 630
HinfI GANTC 1 cut(s) 688
Hpy166II GTNNAC 2 cut(s) 53, 215
Hpy188I TCNGA 2 cut(s) 184, 268
Hpy188III TCNNGA 4 cut(s) 161, 169, 199, 460
Hpy8I GTNNAC 2 cut(s) 53, 215
HpyAV CCTTC 1 cut(s) 88
HpyCH4IV ACGT 2 cut(s) 337, 364
HpyCH4V TGCA 5 cut(s) 27, 131, 248, 617, 638
HpyF3I CTNAG 2 cut(s) 183, 597
HpySE526I ACGT 2 cut(s) 337, 364
Hsp92II CATG 3 cut(s) 31, 76, 463
Kzo9I GATC 1 cut(s) 107
LmnI GCTCC 2 cut(s) 97, 484
LpnPI CCDG 9 cut(s) 25, 44, 87, 114, 226, 270, 296, 499, 526
Lsp1109I GCAGC 9 cut(s) 115, 517, 520, 547, 589, 596, 635, 656, 661
LweI GCATC 3 cut(s) 353, 380, 604
MaeI CTAG 1 cut(s) 588
MaeII ACGT 2 cut(s) 337, 364
MalI GATC 1 cut(s) 109
MboI GATC 1 cut(s) 107
MflI RGATCY 1 cut(s) 107
MluCI AATT 3 cut(s) 194, 434, 474
MseI TTAA 1 cut(s) 222
MslI CAYNNNNRTG 1 cut(s) 461
MspA1I CMGCKG 1 cut(s) 58
MspR9I CCNGG 2 cut(s) 102, 514
MvaI CCWGG 2 cut(s) 102, 514
NdeII GATC 1 cut(s) 107
NlaIII CATG 3 cut(s) 31, 76, 463
NlaIV GGNNCC 2 cut(s) 10, 99
PagI TCATGA 1 cut(s) 459
PasI CCCWGGG 1 cut(s) 513
PfeI GAWTC 1 cut(s) 688
PkrI GCNGC 9 cut(s) 130, 532, 535, 562, 586, 604, 625, 646, 676
Psp6I CCWGG 2 cut(s) 100, 512
PspFI CCCAGC 1 cut(s) 256
PspGI CCWGG 2 cut(s) 100, 512
PspN4I GGNNCC 2 cut(s) 10, 99
PspPI GGNCC 1 cut(s) 9
PsuI RGATCY 1 cut(s) 107
PvuII CAGCTG 1 cut(s) 58
RseI CAYNNNNRTG 1 cut(s) 461
SaqAI TTAA 1 cut(s) 222
SatI GCNGC 9 cut(s) 129, 531, 534, 561, 585, 603, 624, 645, 675
Sau3AI GATC 1 cut(s) 107
Sau96I GGNCC 1 cut(s) 9
ScrFI CCNGG 2 cut(s) 102, 514
SfaNI GCATC 3 cut(s) 353, 380, 604
SinI GGWCC 1 cut(s) 9
SmiMI CAYNNNNRTG 1 cut(s) 461
SmlI CTYRAG 2 cut(s) 159, 537
SmoI CTYRAG 2 cut(s) 159, 537
Sse9I AATT 3 cut(s) 194, 434, 474
SsiI CCGC 1 cut(s) 554
SspI AATATT 1 cut(s) 149
SspMI CTAG 1 cut(s) 588
StyD4I CCNGG 2 cut(s) 100, 512
TaiI ACGT 2 cut(s) 340, 367
TaqI TCGA 1 cut(s) 287
TaqII GACCGA 1 cut(s) 406
TasI AATT 3 cut(s) 194, 434, 474
TfiI GAWTC 1 cut(s) 688
Tru1I TTAA 1 cut(s) 222
Tru9I TTAA 1 cut(s) 222
TscAI CASTG 1 cut(s) 549
TseI GCWGC 9 cut(s) 128, 530, 533, 560, 584, 602, 623, 644, 674
TspDTI ATGAA 2 cut(s) 479, 665
TspRI CASTG 1 cut(s) 549
VpaK11BI GGWCC 1 cut(s) 9
XapI RAATTY 2 cut(s) 194, 434
XspI CTAG 1 cut(s) 588
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.