MD10G1232000.v1.1

Peroxisome biogenesis protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Reverse (-)
32837566 .. 32838844
1279 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1232000.v1.1.491

Sequence Viewer

Length: 306 bp
ATGTTCTCTTTACAATCTCTTCAGTTCGTCGTTGTTGTGCCAAGGTTATCACCAAAAGAGAGCATGAAAAATTCTGCAAATGATGGGTTGCAAACAAGAAGCAGGTCAACTCCAAAGGAATCTAACGGTGGAAGTGACAGAAAGGACAACCGTGAAGCAATTGTTGGGCTGTTGATTTCCGATTCAGTTGTTAAAGGGCATGTAATGATTCAGTTGTATGGCATATACAGCCAGTTCTTGGATTCAAAGAGATCCGTTGCTACACAGTCGAGAGATGCAAAAGGCAAGAGGGCAACCCTGGCCTGA

Protein Analysis

102

Amino Acids

11.09

Weight (kDa)

10.16

Isoelectric Point (pI)

57.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028230)

Species Orthologous Gene IDs
malus_domestica MD10G1232000.v1.1
pyrus_communis pycom10g19530

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 93
AccB7I CCANNNNNTGG 1 cut(s) 238
AclWI GGATC 1 cut(s) 246
AcsI RAATTY 1 cut(s) 70
AcuI CTGAAG 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 238
AgsI TTSAA 1 cut(s) 246
AjnI CCWGG 1 cut(s) 297
AjuI GAANNNNNNNTTGG 2 cut(s) 147, 179
AlwI GGATC 1 cut(s) 246
AoxI GGCC 1 cut(s) 300
ApoI RAATTY 1 cut(s) 70
AsuHPI GGTGA 1 cut(s) 42
BccI CCATC 1 cut(s) 77
BciT130I CCWGG 1 cut(s) 299
BfuAI ACCTGC 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 299
BmrFI CCNGG 1 cut(s) 299
BmsI GCATC 1 cut(s) 265
BsaJI CCNNGG 2 cut(s) 41, 297
Bsc4I CCNNNNNNNGG 1 cut(s) 238
Bse1I ACTGG 1 cut(s) 232
BseBI CCWGG 1 cut(s) 299
BseDI CCNNGG 2 cut(s) 41, 297
BseLI CCNNNNNNNGG 1 cut(s) 238
BseNI ACTGG 1 cut(s) 232
BshFI GGCC 1 cut(s) 302
BslI CCNNNNNNNGG 1 cut(s) 238
BsnI GGCC 1 cut(s) 302
Bsp143I GATC 1 cut(s) 251
BspANI GGCC 1 cut(s) 302
BspMI ACCTGC 1 cut(s) 93
BspPI GGATC 1 cut(s) 246
BsrI ACTGG 1 cut(s) 232
BssECI CCNNGG 2 cut(s) 41, 297
BssMI GATC 1 cut(s) 251
BssT1I CCWWGG 1 cut(s) 41
Bst2UI CCWGG 1 cut(s) 299
Bst4CI ACNGT 3 cut(s) 128, 152, 267
Bst6I CTCTTC 1 cut(s) 24
BstKTI GATC 1 cut(s) 254
BstMBI GATC 1 cut(s) 251
BstMWI GCNNNNNNNGC 2 cut(s) 228, 299
BstNI CCWGG 1 cut(s) 299
BstNSI RCATGY 1 cut(s) 203
BstSCI CCNGG 1 cut(s) 297
BstX2I RGATCY 1 cut(s) 251
BstYI RGATCY 1 cut(s) 251
BsuRI GGCC 1 cut(s) 302
BveI ACCTGC 1 cut(s) 93
CviAII CATG 2 cut(s) 64, 200
CviJI RGCY 3 cut(s) 169, 231, 302
CviKI_1 RGCY 3 cut(s) 169, 231, 302
DpnI GATC 1 cut(s) 253
DpnII GATC 1 cut(s) 251
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
Eco130I CCWWGG 1 cut(s) 41
Eco57I CTGAAG 1 cut(s) 5
EcoRII CCWGG 1 cut(s) 297
EcoT14I CCWWGG 1 cut(s) 41
ErhI CCWWGG 1 cut(s) 41
FaeI CATG 2 cut(s) 67, 203
FaiI YATR 5 cut(s) 65, 201, 219, 224, 226
FatI CATG 2 cut(s) 63, 199
HaeIII GGCC 1 cut(s) 302
Hin1II CATG 2 cut(s) 67, 203
HincII GTYRAC 1 cut(s) 108
HindII GTYRAC 1 cut(s) 108
HinfI GANTC 4 cut(s) 119, 182, 208, 242
HphI GGTGA 1 cut(s) 42
Hpy166II GTNNAC 1 cut(s) 108
Hpy188I TCNGA 1 cut(s) 181
Hpy188III TCNNGA 1 cut(s) 270
Hpy8I GTNNAC 1 cut(s) 108
Hpy99I CGWCG 1 cut(s) 32
HpyCH4III ACNGT 3 cut(s) 128, 152, 267
HpyCH4V TGCA 3 cut(s) 77, 91, 278
HpyF10VI GCNNNNNNNGC 2 cut(s) 228, 299
Hsp92II CATG 2 cut(s) 67, 203
Kzo9I GATC 1 cut(s) 251
LpnPI CCDG 3 cut(s) 88, 245, 284
LweI GCATC 1 cut(s) 265
MaeIII GTNAC 1 cut(s) 134
MalI GATC 1 cut(s) 253
MboI GATC 1 cut(s) 251
MboII GAAGA 1 cut(s) 11
MfeI CAATTG 1 cut(s) 159
MflI RGATCY 1 cut(s) 251
MluCI AATT 2 cut(s) 70, 159
MnlI CCTC 1 cut(s) 282
MseI TTAA 1 cut(s) 192
MspR9I CCNGG 1 cut(s) 299
MunI CAATTG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 299
MwoI GCNNNNNNNGC 2 cut(s) 228, 299
NdeII GATC 1 cut(s) 251
NlaIII CATG 2 cut(s) 67, 203
NmuCI GTSAC 1 cut(s) 134
NspI RCATGY 1 cut(s) 203
PfeI GAWTC 4 cut(s) 119, 182, 208, 242
PflMI CCANNNNNTGG 1 cut(s) 238
Psp6I CCWGG 1 cut(s) 297
PspGI CCWGG 1 cut(s) 297
PsuI RGATCY 1 cut(s) 251
SaqAI TTAA 1 cut(s) 192
Sau3AI GATC 1 cut(s) 251
ScrFI CCNGG 1 cut(s) 299
SetI ASST 2 cut(s) 47, 107
SfaNI GCATC 1 cut(s) 265
Sse9I AATT 2 cut(s) 70, 159
StyD4I CCNGG 1 cut(s) 297
StyI CCWWGG 1 cut(s) 41
TaaI ACNGT 3 cut(s) 128, 152, 267
TaqI TCGA 1 cut(s) 269
TasI AATT 2 cut(s) 70, 159
TfiI GAWTC 4 cut(s) 119, 182, 208, 242
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
TseFI GTSAC 1 cut(s) 134
Tsp45I GTSAC 1 cut(s) 134
TspDTI ATGAA 1 cut(s) 80
TspGWI ACGGA 1 cut(s) 244
Van91I CCANNNNNTGG 1 cut(s) 238
XapI RAATTY 1 cut(s) 70
XceI RCATGY 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.