MD10G1314000.v1.1

Involved in the biosynthesis of lipid A, a phosphorylated glycolipid that in bacteria anchors the lipopolysaccharide to the outer membrane of the cell. Lipid A-like molecules in plants may serve as structural components of the outer membranes of mitochondria and or chloroplasts, or may be involved in signal transduction or plant defense responses

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Forward (+)
39832379 .. 39832856
478 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1314000.v1.1.491

Sequence Viewer

Length: 201 bp
ATGTTTTCATTGATTACGAATATTGCTGAATATTTTTTTACATGGACTTCGCGGCTACGGCTTGCTGCTACTAGCTATGTAATGAAGGATATCACAGGACCTGGAGATAATGGTGGCTTCCCAGCTGTTCATCTCCATGAGTGGCGAAGACAACTAGACAAGTTGCAAATTACTGTCGGACATACAAAAAGTGGAACCTGA

Protein Analysis

67

Amino Acids

7.48

Weight (kDa)

9.4

Isoelectric Point (pI)

27.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028205)

Species Orthologous Gene IDs
malus_domestica MD10G1314000.v1.1
pyrus_communis pycom10g26610

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 52
AciI CCGC 1 cut(s) 52
AjnI CCWGG 1 cut(s) 100
AluBI AGCT 2 cut(s) 75, 125
AluI AGCT 2 cut(s) 75, 125
AlwNI CAGNNNCTG 1 cut(s) 101
ApeKI GCWGC 1 cut(s) 65
AspS9I GGNCC 1 cut(s) 98
AvaII GGWCC 1 cut(s) 98
BbsI GAAGAC 1 cut(s) 154
BbvI GCAGC 1 cut(s) 52
BceAI ACGGC 1 cut(s) 74
BciT130I CCWGG 1 cut(s) 102
BfaI CTAG 2 cut(s) 72, 155
BisI GCNGC 2 cut(s) 53, 66
BlsI GCNGC 2 cut(s) 54, 67
Bme1390I CCNGG 1 cut(s) 102
Bme18I GGWCC 1 cut(s) 98
BmgT120I GGNCC 1 cut(s) 98
BmiI GGNNCC 1 cut(s) 196
BmrFI CCNGG 1 cut(s) 102
BpiI GAAGAC 1 cut(s) 154
BpmI CTGGAG 1 cut(s) 123
BseBI CCWGG 1 cut(s) 102
BseXI GCAGC 1 cut(s) 52
BseYI CCCAGC 1 cut(s) 121
Bsh1236I CGCG 1 cut(s) 52
BspACI CCGC 1 cut(s) 52
BspFNI CGCG 1 cut(s) 52
BspLI GGNNCC 1 cut(s) 196
Bst2UI CCWGG 1 cut(s) 102
Bst4CI ACNGT 1 cut(s) 175
BstC8I GCNNGC 1 cut(s) 63
BstFNI CGCG 1 cut(s) 52
BstMWI GCNNNNNNNGC 1 cut(s) 58
BstNI CCWGG 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 100
BstUI CGCG 1 cut(s) 52
BstV1I GCAGC 1 cut(s) 52
BstV2I GAAGAC 1 cut(s) 154
Cac8I GCNNGC 1 cut(s) 63
CaiI CAGNNNCTG 1 cut(s) 101
Cfr13I GGNCC 1 cut(s) 98
CviAII CATG 2 cut(s) 42, 137
CviJI RGCY 5 cut(s) 55, 61, 75, 117, 125
CviKI_1 RGCY 5 cut(s) 55, 61, 75, 117, 125
Eco32I GATATC 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 98
EcoO109I RGGNCCY 1 cut(s) 98
EcoRII CCWGG 1 cut(s) 100
EcoRV GATATC 1 cut(s) 91
FaeI CATG 2 cut(s) 45, 140
FaiI YATR 4 cut(s) 43, 78, 138, 183
FatI CATG 2 cut(s) 41, 136
Fnu4HI GCNGC 2 cut(s) 53, 66
Fsp4HI GCNGC 2 cut(s) 53, 66
FspBI CTAG 2 cut(s) 72, 155
GluI GCNGC 2 cut(s) 53, 66
GsaI CCCAGC 1 cut(s) 125
GsuI CTGGAG 1 cut(s) 123
Hin1II CATG 2 cut(s) 45, 140
Hpy188I TCNGA 1 cut(s) 179
HpyAV CCTTC 1 cut(s) 79
HpyCH4III ACNGT 1 cut(s) 175
HpyCH4V TGCA 1 cut(s) 166
HpyF10VI GCNNNNNNNGC 1 cut(s) 58
Hsp92II CATG 2 cut(s) 45, 140
LpnPI CCDG 4 cut(s) 81, 87, 114, 135
Lsp1109I GCAGC 1 cut(s) 52
MaeI CTAG 2 cut(s) 72, 155
MboII GAAGA 1 cut(s) 159
MluCI AATT 1 cut(s) 168
MmeI TCCRAC 1 cut(s) 157
MslI CAYNNNNRTG 1 cut(s) 135
MspA1I CMGCKG 1 cut(s) 125
MspR9I CCNGG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 102
MvnI CGCG 1 cut(s) 52
MwoI GCNNNNNNNGC 1 cut(s) 58
NlaIII CATG 2 cut(s) 45, 140
NlaIV GGNNCC 1 cut(s) 196
PkrI GCNGC 2 cut(s) 54, 67
PpuMI RGGWCCY 1 cut(s) 98
Psp5II RGGWCCY 1 cut(s) 98
Psp6I CCWGG 1 cut(s) 100
PspFI CCCAGC 1 cut(s) 121
PspGI CCWGG 1 cut(s) 100
PspN4I GGNNCC 1 cut(s) 196
PspPI GGNCC 1 cut(s) 98
PspPPI RGGWCCY 1 cut(s) 98
PstNI CAGNNNCTG 1 cut(s) 101
PvuII CAGCTG 1 cut(s) 125
RseI CAYNNNNRTG 1 cut(s) 135
SatI GCNGC 2 cut(s) 53, 66
Sau96I GGNCC 1 cut(s) 98
ScrFI CCNGG 1 cut(s) 102
SetI ASST 4 cut(s) 77, 103, 127, 200
SinI GGWCC 1 cut(s) 98
SmiMI CAYNNNNRTG 1 cut(s) 135
Sse9I AATT 1 cut(s) 168
SsiI CCGC 1 cut(s) 52
SspI AATATT 2 cut(s) 22, 32
SspMI CTAG 2 cut(s) 72, 155
StyD4I CCNGG 1 cut(s) 100
TaaI ACNGT 1 cut(s) 175
TasI AATT 1 cut(s) 168
TauI GCSGC 1 cut(s) 55
TseI GCWGC 1 cut(s) 65
TspDTI ATGAA 2 cut(s) 98, 119
VpaK11BI GGWCC 1 cut(s) 98
XspI CTAG 2 cut(s) 72, 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.