MD12G1084500.v1.1

Pentatricopeptide repeat-containing protein At1g56690, mitochondrial-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
Physical Location & Seq
Forward (+)
10356517 .. 10357927
1411 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1084500.v1.1.491

Sequence Viewer

Length: 351 bp
ATGCTGGCTCGGTTTATTCTATCTCAGAAATATGGCACTGGTATTGCAATTTCCGCCAATTCTCAGATTGCTCAGTATGCTTGGCTTGGCCAAATTGAGAAAGCCCGAAGGGTGTTTGATCAAATGCCTGATAAAAATATTGTGTCTTGGAACTCAATGGTTGGAGGTTACTTCCAAGGTAATCAGCCAGGAGAAGCCCGAAGATTGTTTGATAAAATGCAGGAGCGGAATACAGTTTCTTGGAACGGTTTGATATCAGGGTATGTCAAGAATGGGATGATTAGTGAGGCTAGGAAAGTGTTTGATTCAATGCCCGAAAGGAACGTTGTTTCATGGACATTGATGGTTTGA

Protein Analysis

117

Amino Acids

13.21

Weight (kDa)

9.81

Isoelectric Point (pI)

45.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 45 - 77 2.3e-07 PPR repeat family
PPR PF01535 48 - 77 1.6e-07 PPR repeat
PPR_2 PF13041 76 - 109 4.9e-09 PPR repeat family
PPR_1 PF12854 76 - 104 1.1e-06 PPR repeat
PPR PF01535 79 - 109 6.8e-10 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024421)

Species Orthologous Gene IDs
malus_domestica MD12G1084500.v1.1
pyrus_communis pycom12g07160 pycom14g06780

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 226
AciI CCGC 2 cut(s) 54, 226
AclI AACGTT 1 cut(s) 324
AcoI YGGCCR 1 cut(s) 88
AgsI TTSAA 1 cut(s) 309
AjnI CCWGG 1 cut(s) 187
AoxI GGCC 1 cut(s) 88
BalI TGGCCA 1 cut(s) 90
BccI CCATC 1 cut(s) 337
BciT130I CCWGG 1 cut(s) 189
BclI TGATCA 1 cut(s) 118
BfaI CTAG 1 cut(s) 291
Bme1390I CCNGG 1 cut(s) 189
BmrFI CCNGG 1 cut(s) 189
BsaJI CCNNGG 1 cut(s) 175
Bse1I ACTGG 1 cut(s) 43
BseBI CCWGG 1 cut(s) 189
BseDI CCNNGG 1 cut(s) 175
BseGI GGATG 1 cut(s) 282
BseMII CTCAG 3 cut(s) 38, 77, 86
BseNI ACTGG 1 cut(s) 43
BshFI GGCC 1 cut(s) 90
BsnI GGCC 1 cut(s) 90
Bsp143I GATC 1 cut(s) 118
BspACI CCGC 2 cut(s) 54, 226
BspANI GGCC 1 cut(s) 90
BspCNI CTCAG 3 cut(s) 37, 76, 85
BsrBI CCGCTC 1 cut(s) 226
BsrI ACTGG 1 cut(s) 43
BssECI CCNNGG 1 cut(s) 175
BssMI GATC 1 cut(s) 118
BssT1I CCWWGG 1 cut(s) 175
Bst2UI CCWGG 1 cut(s) 189
Bst4CI ACNGT 2 cut(s) 235, 248
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 3 cut(s) 24, 63, 72
BstF5I GGATG 1 cut(s) 282
BstKTI GATC 1 cut(s) 121
BstMBI GATC 1 cut(s) 118
BstMWI GCNNNNNNNGC 2 cut(s) 53, 77
BstNI CCWGG 1 cut(s) 189
BstSCI CCNGG 1 cut(s) 187
BsuRI GGCC 1 cut(s) 90
BtsCI GGATG 1 cut(s) 282
BtsIMutI CAGTG 1 cut(s) 36
Cac8I GCNNGC 1 cut(s) 6
CviAII CATG 1 cut(s) 333
CviJI RGCY 7 cut(s) 8, 85, 90, 104, 187, 197, 290
CviKI_1 RGCY 7 cut(s) 8, 85, 90, 104, 187, 197, 290
DdeI CTNAG 3 cut(s) 24, 63, 72
DpnI GATC 1 cut(s) 120
DpnII GATC 1 cut(s) 118
EaeI YGGCCR 1 cut(s) 88
EciI GGCGGA 1 cut(s) 43
Eco130I CCWWGG 1 cut(s) 175
Eco32I GATATC 1 cut(s) 255
EcoRII CCWGG 1 cut(s) 187
EcoRV GATATC 1 cut(s) 255
EcoT14I CCWWGG 1 cut(s) 175
ErhI CCWWGG 1 cut(s) 175
FaeI CATG 1 cut(s) 336
FaiI YATR 4 cut(s) 33, 78, 264, 334
FatI CATG 1 cut(s) 332
FbaI TGATCA 1 cut(s) 118
FokI GGATG 1 cut(s) 289
FspBI CTAG 1 cut(s) 291
HaeIII GGCC 1 cut(s) 90
Hin1II CATG 1 cut(s) 336
HinfI GANTC 1 cut(s) 305
Hpy188I TCNGA 2 cut(s) 27, 66
Hpy188III TCNNGA 1 cut(s) 268
HpyAV CCTTC 1 cut(s) 102
HpyCH4III ACNGT 2 cut(s) 235, 248
HpyCH4IV ACGT 1 cut(s) 324
HpyCH4V TGCA 2 cut(s) 47, 220
HpyF10VI GCNNNNNNNGC 2 cut(s) 53, 77
HpyF3I CTNAG 3 cut(s) 24, 63, 72
HpySE526I ACGT 1 cut(s) 324
Hsp92II CATG 1 cut(s) 336
Ksp22I TGATCA 1 cut(s) 118
Kzo9I GATC 1 cut(s) 118
LmnI GCTCC 1 cut(s) 223
LpnPI CCDG 6 cut(s) 24, 141, 174, 201, 206, 243
MaeI CTAG 1 cut(s) 291
MaeII ACGT 1 cut(s) 324
MaeIII GTNAC 1 cut(s) 167
MalI GATC 1 cut(s) 120
MbiI CCGCTC 1 cut(s) 226
MboI GATC 1 cut(s) 118
MboII GAAGA 1 cut(s) 213
MlsI TGGCCA 1 cut(s) 90
MluCI AATT 3 cut(s) 48, 58, 93
MluNI TGGCCA 1 cut(s) 90
MmeI TCCRAC 1 cut(s) 142
MnlI CCTC 2 cut(s) 158, 280
Mox20I TGGCCA 1 cut(s) 90
MscI TGGCCA 1 cut(s) 90
Msp20I TGGCCA 1 cut(s) 90
MspR9I CCNGG 1 cut(s) 189
MvaI CCWGG 1 cut(s) 189
MwoI GCNNNNNNNGC 2 cut(s) 53, 77
NdeII GATC 1 cut(s) 118
NlaIII CATG 1 cut(s) 336
PfeI GAWTC 1 cut(s) 305
Psp1406I AACGTT 1 cut(s) 324
Psp6I CCWGG 1 cut(s) 187
PspGI CCWGG 1 cut(s) 187
Sau3AI GATC 1 cut(s) 118
ScrFI CCNGG 1 cut(s) 189
SetI ASST 3 cut(s) 169, 181, 327
Sse9I AATT 3 cut(s) 48, 58, 93
SsiI CCGC 2 cut(s) 54, 226
SspI AATATT 1 cut(s) 139
SspMI CTAG 1 cut(s) 291
StyD4I CCNGG 1 cut(s) 187
StyI CCWWGG 1 cut(s) 175
TaaI ACNGT 2 cut(s) 235, 248
TaiI ACGT 1 cut(s) 327
TasI AATT 3 cut(s) 48, 58, 93
TfiI GAWTC 1 cut(s) 305
TscAI CASTG 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 321
TspRI CASTG 1 cut(s) 43
XspI CTAG 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.