MD12G1175500.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0028727
Physical Location & Seq
Reverse (-)
25609620 .. 25612338
2719 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1175500.v1.1.491

Sequence Viewer

Length: 165 bp
ATGTTTGTTTTTTTGCAATTTTTGGTGTATGCGATCTCGAAGCATATACAAACAAGTTTGACGGTTAGATCATTGAAACTAGTTTCGTACAATGCGTATCCCATCAAGTTCAATGGTATATATATTTACAAAGTAGATTTTAATTTATTTATTTTGTACTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.46

Weight (kDa)

9.63

Isoelectric Point (pI)

24.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0028727)

Species Orthologous Gene IDs
malus_domestica MD12G1175500.v1.1
pyrus_communis pycom03g15960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 163
AfaI GTAC 2 cut(s) 89, 158
AgsI TTSAA 2 cut(s) 76, 112
AhlI ACTAGT 1 cut(s) 79
BccI CCATC 1 cut(s) 110
BciVI GTATCC 1 cut(s) 108
BcuI ACTAGT 1 cut(s) 79
BfaI CTAG 1 cut(s) 80
BfuI GTATCC 1 cut(s) 108
Bsp143I GATC 2 cut(s) 33, 68
BssMI GATC 2 cut(s) 33, 68
Bst4CI ACNGT 1 cut(s) 64
BstKTI GATC 2 cut(s) 36, 71
BstMBI GATC 2 cut(s) 33, 68
BsuI GTATCC 1 cut(s) 108
Csp6I GTAC 2 cut(s) 88, 157
CviQI GTAC 2 cut(s) 88, 157
DpnI GATC 2 cut(s) 35, 70
DpnII GATC 2 cut(s) 33, 68
FaiI YATR 7 cut(s) 30, 45, 47, 119, 121, 123, 163
FspBI CTAG 1 cut(s) 80
FspEI CC 5 cut(s) 8, 47, 99, 114, 115
Hpy188III TCNNGA 1 cut(s) 37
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 1 cut(s) 16
Kzo9I GATC 2 cut(s) 33, 68
MaeI CTAG 1 cut(s) 80
MalI GATC 2 cut(s) 35, 70
MboI GATC 2 cut(s) 33, 68
MluCI AATT 2 cut(s) 17, 142
MseI TTAA 1 cut(s) 141
NdeII GATC 2 cut(s) 33, 68
PcsI WCGNNNNNNNCGW 1 cut(s) 92
PsiI TTATAA 1 cut(s) 163
RsaI GTAC 2 cut(s) 89, 158
RsaNI GTAC 2 cut(s) 88, 157
SaqAI TTAA 1 cut(s) 141
Sau3AI GATC 2 cut(s) 33, 68
SgeI CNNG 4 cut(s) 49, 66, 92, 118
SpeI ACTAGT 1 cut(s) 79
Sse9I AATT 2 cut(s) 17, 142
SspMI CTAG 1 cut(s) 80
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 1 cut(s) 38
TasI AATT 2 cut(s) 17, 142
TatI WGTACW 1 cut(s) 156
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
XspI CTAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.