MD13G1041900.v1.1

RuBisCO catalyzes two reactions the carboxylation of D- ribulose 1,5-bisphosphate, the primary event in carbon dioxide fixation, as well as the oxidative fragmentation of the pentose substrate. Both reactions occur simultaneously and in competition at the same active site

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0028272
Physical Location & Seq
Reverse (-)
2862691 .. 2863563
873 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1041900.v1.1.491

Sequence Viewer

Length: 225 bp
ATGCAGGTGTGGCCAACAATTGGACTGAAGAAGTTTGAGACTCTCTCTTACCTTCCTCCCTTGTCTGCCGAGTCATTGGCAAAGGAAGTAGACTACCTTCTCCGCAACAACTGGGTTCCCACCTTGGAATTCGAGTTGGAGGTAATTAACATTCACAAATCACTCTTTAGCTCGTGTAAATGCAACAAAAAAAATTATAAAATATTCAATTTAAAATTCATATGA

Protein Analysis

75

Amino Acids

8.72

Weight (kDa)

8.98

Isoelectric Point (pI)

35.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RuBisCO_small PF00101 12 - 47 2e-08 Ribulose bisphosphate carboxylase, small chain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0028272)

Species Orthologous Gene IDs
malus_domestica MD13G1041900.v1.1
prunus_persica Prupe.4G198400_v2.0.a1

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 198
AccB7I CCANNNNNTGG 1 cut(s) 20
AccI GTMKAC 1 cut(s) 90
AciI CCGC 1 cut(s) 103
AcoI YGGCCR 1 cut(s) 11
AcsI RAATTY 2 cut(s) 128, 215
AcuI CTGAAG 1 cut(s) 47
AfiI CCNNNNNNNGG 1 cut(s) 20
AgsI TTSAA 1 cut(s) 208
AluBI AGCT 1 cut(s) 171
AluI AGCT 1 cut(s) 171
Alw26I GTCTC 1 cut(s) 32
AoxI GGCC 1 cut(s) 11
ApoI RAATTY 2 cut(s) 128, 215
BalI TGGCCA 1 cut(s) 13
BarI GAAGNNNNNNTAC 2 cut(s) 81, 113
BauI CACGAG 1 cut(s) 172
BcoDI GTCTC 1 cut(s) 32
BmiI GGNNCC 1 cut(s) 117
BmrI ACTGGG 1 cut(s) 121
BmuI ACTGGG 1 cut(s) 121
BplI GAGNNNNNCTC 2 cut(s) 29, 61
BsaJI CCNNGG 1 cut(s) 123
Bsc4I CCNNNNNNNGG 1 cut(s) 20
Bse1I ACTGG 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 20
BseNI ACTGG 1 cut(s) 116
BshFI GGCC 1 cut(s) 13
BslI CCNNNNNNNGG 1 cut(s) 20
BsmAI GTCTC 1 cut(s) 32
BsnI GGCC 1 cut(s) 13
BspACI CCGC 1 cut(s) 103
BspANI GGCC 1 cut(s) 13
BspLI GGNNCC 1 cut(s) 117
BsrI ACTGG 1 cut(s) 116
BssECI CCNNGG 1 cut(s) 123
BssSI CACGAG 1 cut(s) 172
BssT1I CCWWGG 1 cut(s) 123
Bst2BI CACGAG 1 cut(s) 172
BstMAI GTCTC 1 cut(s) 32
BstMWI GCNNNNNNNGC 1 cut(s) 10
BsuRI GGCC 1 cut(s) 13
CviJI RGCY 2 cut(s) 13, 171
CviKI_1 RGCY 2 cut(s) 13, 171
DraI TTTAAA 1 cut(s) 213
EaeI YGGCCR 1 cut(s) 11
Eco130I CCWWGG 1 cut(s) 123
Eco57I CTGAAG 1 cut(s) 47
EcoRI GAATTC 1 cut(s) 128
EcoT14I CCWWGG 1 cut(s) 123
ErhI CCWWGG 1 cut(s) 123
FaiI YATR 3 cut(s) 198, 221, 223
FauNDI CATATG 1 cut(s) 221
FblI GTMKAC 1 cut(s) 90
HaeIII GGCC 1 cut(s) 13
HinfI GANTC 2 cut(s) 40, 71
Hpy166II GTNNAC 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 91
HpyAV CCTTC 2 cut(s) 62, 107
HpyCH4V TGCA 2 cut(s) 4, 183
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
LpnPI CCDG 1 cut(s) 97
MboII GAAGA 1 cut(s) 40
MfeI CAATTG 1 cut(s) 18
MlsI TGGCCA 1 cut(s) 13
MluCI AATT 6 cut(s) 18, 128, 144, 193, 208, 215
MluNI TGGCCA 1 cut(s) 13
MlyI GAGTC 2 cut(s) 34, 80
MmeI TCCRAC 1 cut(s) 117
MnlI CCTC 2 cut(s) 66, 133
Mox20I TGGCCA 1 cut(s) 13
MscI TGGCCA 1 cut(s) 13
MseI TTAA 2 cut(s) 147, 212
Msp20I TGGCCA 1 cut(s) 13
MunI CAATTG 1 cut(s) 18
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeI CATATG 1 cut(s) 221
NlaIV GGNNCC 1 cut(s) 117
NmeAIII GCCGAG 1 cut(s) 94
PflMI CCANNNNNTGG 1 cut(s) 20
PleI GAGTC 2 cut(s) 34, 79
PpsI GAGTC 2 cut(s) 34, 79
PsiI TTATAA 1 cut(s) 198
PspN4I GGNNCC 1 cut(s) 117
SaqAI TTAA 2 cut(s) 147, 212
SchI GAGTC 2 cut(s) 34, 80
SetI ASST 6 cut(s) 9, 54, 99, 125, 144, 173
SgeI CNNG 8 cut(s) 17, 73, 82, 124, 136, 145, 184, 186
Sse9I AATT 6 cut(s) 18, 128, 144, 193, 208, 215
SsiI CCGC 1 cut(s) 103
SspI AATATT 1 cut(s) 204
StyI CCWWGG 1 cut(s) 123
TaqI TCGA 1 cut(s) 132
TasI AATT 6 cut(s) 18, 128, 144, 193, 208, 215
Tru1I TTAA 2 cut(s) 147, 212
Tru9I TTAA 2 cut(s) 147, 212
TspDTI ATGAA 1 cut(s) 208
Van91I CCANNNNNTGG 1 cut(s) 20
XapI RAATTY 2 cut(s) 128, 215
XmiI GTMKAC 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.