MD14G1099000.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
Physical Location & Seq
Reverse (-)
15139079 .. 15143291
4213 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1099000.v1.1.491

Sequence Viewer

Length: 183 bp
ATGTGTTACACCATGTACCTTAAAATATTGTATTTTATTCTTAAACCATGTGAATTGACCAAATTACCCTTGGATGGGTGTCTTGAGAAATTTTTAAGCCTTGACTCGAACTTCAATTTCTTATACTTTCTTAGTCTTCATAAATATTCATGTCATTCGAATGAGATCGGAAACAAAATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

7.12

Weight (kDa)

7.66

Isoelectric Point (pI)

34.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028323)

Species Orthologous Gene IDs
malus_domestica MD14G1099000.v1.1
pyrus_communis pycom16g20790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 89, 177
AfaI GTAC 1 cut(s) 17
AfiI CCNNNNNNNGG 2 cut(s) 74, 75
AgsI TTSAA 1 cut(s) 115
ApoI RAATTY 2 cut(s) 89, 177
AsuII TTCGAA 1 cut(s) 158
BbsI GAAGAC 1 cut(s) 128
BccI CCATC 1 cut(s) 68
BpiI GAAGAC 1 cut(s) 128
Bpu14I TTCGAA 1 cut(s) 158
BpuEI CTTGAG 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 69
Bsc4I CCNNNNNNNGG 2 cut(s) 74, 75
BseDI CCNNGG 1 cut(s) 69
BseGI GGATG 1 cut(s) 79
BseLI CCNNNNNNNGG 2 cut(s) 74, 75
BslI CCNNNNNNNGG 2 cut(s) 74, 75
Bsp119I TTCGAA 1 cut(s) 158
Bsp143I GATC 1 cut(s) 165
BspT104I TTCGAA 1 cut(s) 158
BssECI CCNNGG 1 cut(s) 69
BssMI GATC 1 cut(s) 165
BssT1I CCWWGG 1 cut(s) 69
BstBI TTCGAA 1 cut(s) 158
BstDEI CTNAG 1 cut(s) 131
BstF5I GGATG 1 cut(s) 79
BstKTI GATC 1 cut(s) 168
BstMBI GATC 1 cut(s) 165
BstV2I GAAGAC 1 cut(s) 128
BtsCI GGATG 1 cut(s) 79
Csp6I GTAC 1 cut(s) 16
CviAII CATG 3 cut(s) 13, 48, 150
CviJI RGCY 1 cut(s) 99
CviKI_1 RGCY 1 cut(s) 99
CviQI GTAC 1 cut(s) 16
DdeI CTNAG 1 cut(s) 131
DpnI GATC 1 cut(s) 167
DpnII GATC 1 cut(s) 165
Eco130I CCWWGG 1 cut(s) 69
EcoT14I CCWWGG 1 cut(s) 69
ErhI CCWWGG 1 cut(s) 69
FaeI CATG 3 cut(s) 16, 51, 153
FaiI YATR 5 cut(s) 14, 49, 124, 141, 151
FatI CATG 3 cut(s) 12, 47, 149
FokI GGATG 1 cut(s) 86
Hin1II CATG 3 cut(s) 16, 51, 153
HinfI GANTC 1 cut(s) 104
Hpy188I TCNGA 1 cut(s) 170
Hpy188III TCNNGA 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 131
Hsp92II CATG 3 cut(s) 16, 51, 153
Kzo9I GATC 1 cut(s) 165
MaeIII GTNAC 1 cut(s) 5
MalI GATC 1 cut(s) 167
MboI GATC 1 cut(s) 165
MboII GAAGA 1 cut(s) 128
MluCI AATT 5 cut(s) 53, 62, 89, 115, 177
MlyI GAGTC 1 cut(s) 98
MseI TTAA 4 cut(s) 21, 42, 95, 181
MslI CAYNNNNRTG 1 cut(s) 159
NdeII GATC 1 cut(s) 165
NlaIII CATG 3 cut(s) 16, 51, 153
NspV TTCGAA 1 cut(s) 158
PleI GAGTC 1 cut(s) 98
PpsI GAGTC 1 cut(s) 98
RsaI GTAC 1 cut(s) 17
RsaNI GTAC 1 cut(s) 16
RseI CAYNNNNRTG 1 cut(s) 159
SaqAI TTAA 4 cut(s) 21, 42, 95, 181
Sau3AI GATC 1 cut(s) 165
SchI GAGTC 1 cut(s) 98
SetI ASST 1 cut(s) 21
SfuI TTCGAA 1 cut(s) 158
SgeI CNNG 7 cut(s) 25, 60, 82, 95, 113, 118, 162
SmiMI CAYNNNNRTG 1 cut(s) 159
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
Sse9I AATT 5 cut(s) 53, 62, 89, 115, 177
SspI AATATT 2 cut(s) 27, 146
StyI CCWWGG 1 cut(s) 69
TaqI TCGA 2 cut(s) 107, 158
TasI AATT 5 cut(s) 53, 62, 89, 115, 177
Tru1I TTAA 4 cut(s) 21, 42, 95, 181
Tru9I TTAA 4 cut(s) 21, 42, 95, 181
TspDTI ATGAA 2 cut(s) 128, 138
XapI RAATTY 2 cut(s) 89, 177
XcmI CCANNNNNNNNNTGG 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.