Prupe.1G374500_v2.0.a1

expressed protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0024522
Physical Location & Seq
Reverse (-)
34001395 .. 34001520
126 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G374500.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 126 bp
ATGTCTCCAGTTCTCAGTGAAATCCTCCGTTCCGGGTTTATGGTCGATTCCTCCCTCAGGCGCAGGACCCATTTAGTTCAATCTTTCTCTGTTGTCTTCCTCTACTGGTTTTATGTGTTTTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

42

Amino Acids

4.89

Weight (kDa)

9.97

Isoelectric Point (pI)

119.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024522)

Species Orthologous Gene IDs
prunus_persica Prupe.1G374500_v2.0.a1 Prupe.7G160500_v2.0.a1 Prupe.8G091700_v2.0.a1

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 57
AgsI TTSAA 1 cut(s) 80
Alw26I GTCTC 1 cut(s) 9
AspLEI GCGC 1 cut(s) 63
AspS9I GGNCC 1 cut(s) 66
AsuC2I CCSGG 1 cut(s) 34
AvaII GGWCC 1 cut(s) 66
AxyI CCTNAGG 1 cut(s) 56
BbsI GAAGAC 1 cut(s) 88
BcnI CCSGG 1 cut(s) 34
BcoDI GTCTC 1 cut(s) 9
Bme1390I CCNGG 1 cut(s) 34
Bme18I GGWCC 1 cut(s) 66
BmgT120I GGNCC 1 cut(s) 66
BmiI GGNNCC 1 cut(s) 68
BmrFI CCNGG 1 cut(s) 34
BpiI GAAGAC 1 cut(s) 88
BpuMI CCSGG 1 cut(s) 34
Bsc4I CCNNNNNNNGG 1 cut(s) 57
Bse1I ACTGG 2 cut(s) 8, 110
Bse21I CCTNAGG 1 cut(s) 56
BseLI CCNNNNNNNGG 1 cut(s) 57
BseMII CTCAG 2 cut(s) 28, 70
BseNI ACTGG 2 cut(s) 8, 110
BsiSI CCGG 1 cut(s) 33
BslI CCNNNNNNNGG 1 cut(s) 57
BsmAI GTCTC 1 cut(s) 9
BspCNI CTCAG 2 cut(s) 27, 69
BspLI GGNNCC 1 cut(s) 68
BsrI ACTGG 2 cut(s) 8, 110
BstDEI CTNAG 2 cut(s) 14, 56
BstENI CCTNNNNNAGG 1 cut(s) 55
BstHHI GCGC 1 cut(s) 63
BstMAI GTCTC 1 cut(s) 9
BstSCI CCNGG 1 cut(s) 32
BstV2I GAAGAC 1 cut(s) 88
Bsu36I CCTNAGG 1 cut(s) 56
BtsIMutI CAGTG 1 cut(s) 22
CfoI GCGC 1 cut(s) 63
Cfr13I GGNCC 1 cut(s) 66
DdeI CTNAG 2 cut(s) 14, 56
Eco47I GGWCC 1 cut(s) 66
Eco81I CCTNAGG 1 cut(s) 56
EcoNI CCTNNNNNAGG 1 cut(s) 55
EcoO109I RGGNCCY 1 cut(s) 66
FaiI YATR 3 cut(s) 41, 114, 124
GlaI GCGC 1 cut(s) 62
HapII CCGG 1 cut(s) 33
HhaI GCGC 1 cut(s) 63
Hin6I GCGC 1 cut(s) 61
HinP1I GCGC 1 cut(s) 61
HinfI GANTC 1 cut(s) 47
HpaII CCGG 1 cut(s) 33
HpyF3I CTNAG 2 cut(s) 14, 56
HspAI GCGC 1 cut(s) 61
LpnPI CCDG 5 cut(s) 21, 43, 46, 49, 91
MboII GAAGA 1 cut(s) 88
MnlI CCTC 4 cut(s) 35, 61, 65, 110
MspI CCGG 1 cut(s) 33
MspR9I CCNGG 1 cut(s) 34
NciI CCSGG 1 cut(s) 34
NlaIV GGNNCC 1 cut(s) 68
PfeI GAWTC 1 cut(s) 47
PpuMI RGGWCCY 1 cut(s) 66
Psp5II RGGWCCY 1 cut(s) 66
PspN4I GGNNCC 1 cut(s) 68
PspPI GGNCC 1 cut(s) 66
PspPPI RGGWCCY 1 cut(s) 66
Sau96I GGNCC 1 cut(s) 66
ScrFI CCNGG 1 cut(s) 34
SgeI CNNG 6 cut(s) 20, 45, 46, 70, 76, 118
SinI GGWCC 1 cut(s) 66
StyD4I CCNGG 1 cut(s) 32
TaqI TCGA 1 cut(s) 45
TfiI GAWTC 1 cut(s) 47
TscAI CASTG 1 cut(s) 22
TspDTI ATGAA 1 cut(s) 111
TspGWI ACGGA 1 cut(s) 17
TspRI CASTG 1 cut(s) 22
VpaK11BI GGWCC 1 cut(s) 66
XagI CCTNNNNNAGG 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.