Prupe.6G288400_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
26678307 .. 26678940
634 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G288400.1

Sequence Viewer

Length: 225 bp
ATGGCTAGATTTAAGGATGTCATGTCGACAGCCATGGCCGTAATATTTCTGAGGAAGAGCATTTACGTGTACGAGGAATTCGGGGTTTTGTTAATAGACTTCGTTTCTGTTGTAACATCCACCATCCAAGTTTCTGGTTTTGTTTTCCACAGAAGTACAAGGGTCTCTAATTCTACAGGCAGGACCTCTCCCATGTCTTCTATGTTAGCTCGACCCGATCGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.33

Weight (kDa)

10.39

Isoelectric Point (pI)

37.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021228)

Species Orthologous Gene IDs
prunus_persica Prupe.6G288400_v2.0.a1
pyrus_communis pycom12g17260
rosa_chinensis RchiOBHm_Chr3g0461331
rosa_roxburghii Rroxscaffold_6G00418400 Rroxscaffold_6G00418690

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 26
AcoI YGGCCR 1 cut(s) 36
AcsI RAATTY 1 cut(s) 77
AfaI GTAC 2 cut(s) 71, 157
AflIII ACRYGT 1 cut(s) 66
AluBI AGCT 1 cut(s) 209
AluI AGCT 1 cut(s) 209
Alw26I GTCTC 1 cut(s) 169
AoxI GGCC 1 cut(s) 36
ApoI RAATTY 1 cut(s) 77
AspS9I GGNCC 1 cut(s) 183
AvaII GGWCC 1 cut(s) 183
BarI GAAGNNNNNNTAC 2 cut(s) 47, 79
BbsI GAAGAC 1 cut(s) 189
BccI CCATC 1 cut(s) 131
BceAI ACGGC 1 cut(s) 23
BcoDI GTCTC 1 cut(s) 169
BfaI CTAG 1 cut(s) 6
BfmI CTRYAG 1 cut(s) 174
Bme18I GGWCC 1 cut(s) 183
BmgT120I GGNCC 1 cut(s) 183
BpiI GAAGAC 1 cut(s) 189
BsaAI YACGTR 1 cut(s) 67
BsaI GGTCTC 1 cut(s) 169
BsaJI CCNNGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 33
BseGI GGATG 3 cut(s) 22, 116, 123
BseMII CTCAG 1 cut(s) 41
Bsh1285I CGRYCG 1 cut(s) 220
BshFI GGCC 1 cut(s) 38
BsiEI CGRYCG 1 cut(s) 220
BsmAI GTCTC 1 cut(s) 169
BsnI GGCC 1 cut(s) 38
Bso31I GGTCTC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 217
Bsp19I CCATGG 1 cut(s) 33
BspANI GGCC 1 cut(s) 38
BspCNI CTCAG 1 cut(s) 42
BspQI GCTCTTC 1 cut(s) 50
BspTNI GGTCTC 1 cut(s) 169
BssECI CCNNGG 1 cut(s) 33
BssMI GATC 1 cut(s) 217
BssT1I CCWWGG 1 cut(s) 33
Bst6I CTCTTC 1 cut(s) 50
BstBAI YACGTR 1 cut(s) 67
BstDEI CTNAG 1 cut(s) 50
BstDSI CCRYGG 1 cut(s) 33
BstF5I GGATG 3 cut(s) 22, 116, 123
BstKTI GATC 1 cut(s) 220
BstMAI GTCTC 1 cut(s) 169
BstMBI GATC 1 cut(s) 217
BstMCI CGRYCG 1 cut(s) 220
BstSFI CTRYAG 1 cut(s) 174
BstV2I GAAGAC 1 cut(s) 189
BstXI CCANNNNNNTGG 1 cut(s) 134
BsuRI GGCC 1 cut(s) 38
BtgI CCRYGG 1 cut(s) 33
BtsCI GGATG 3 cut(s) 22, 116, 123
Cfr13I GGNCC 1 cut(s) 183
Csp6I GTAC 2 cut(s) 70, 156
CviAII CATG 3 cut(s) 22, 34, 193
CviJI RGCY 4 cut(s) 5, 32, 38, 209
CviKI_1 RGCY 4 cut(s) 5, 32, 38, 209
CviQI GTAC 2 cut(s) 70, 156
DdeI CTNAG 1 cut(s) 50
DpnI GATC 1 cut(s) 219
DpnII GATC 1 cut(s) 217
EaeI YGGCCR 1 cut(s) 36
Eam1104I CTCTTC 1 cut(s) 50
EarI CTCTTC 1 cut(s) 50
Eco130I CCWWGG 1 cut(s) 33
Eco31I GGTCTC 1 cut(s) 169
Eco47I GGWCC 1 cut(s) 183
EcoO109I RGGNCCY 1 cut(s) 183
EcoRI GAATTC 1 cut(s) 77
EcoT14I CCWWGG 1 cut(s) 33
ErhI CCWWGG 1 cut(s) 33
FaeI CATG 3 cut(s) 25, 37, 196
FaiI YATR 4 cut(s) 23, 35, 194, 203
FatI CATG 3 cut(s) 21, 33, 192
FblI GTMKAC 1 cut(s) 26
FokI GGATG 3 cut(s) 29, 103, 110
FspBI CTAG 1 cut(s) 6
HaeIII GGCC 1 cut(s) 38
Hin1II CATG 3 cut(s) 25, 37, 196
HincII GTYRAC 1 cut(s) 27
HindII GTYRAC 1 cut(s) 27
Hpy166II GTNNAC 2 cut(s) 27, 70
Hpy188I TCNGA 1 cut(s) 51
Hpy8I GTNNAC 2 cut(s) 27, 70
HpyCH4IV ACGT 1 cut(s) 66
HpyF3I CTNAG 1 cut(s) 50
HpySE526I ACGT 1 cut(s) 66
Hsp92II CATG 3 cut(s) 25, 37, 196
Kzo9I GATC 1 cut(s) 217
LguI GCTCTTC 1 cut(s) 50
LpnPI CCDG 3 cut(s) 120, 162, 166
MaeI CTAG 1 cut(s) 6
MaeII ACGT 1 cut(s) 66
MaeIII GTNAC 1 cut(s) 112
MalI GATC 1 cut(s) 219
MboI GATC 1 cut(s) 217
MboII GAAGA 2 cut(s) 67, 189
MluCI AATT 2 cut(s) 77, 169
MnlI CCTC 3 cut(s) 45, 67, 196
MseI TTAA 2 cut(s) 12, 92
MslI CAYNNNNRTG 1 cut(s) 65
NcoI CCATGG 1 cut(s) 33
NdeII GATC 1 cut(s) 217
NlaIII CATG 3 cut(s) 25, 37, 196
PciSI GCTCTTC 1 cut(s) 50
Ple19I CGATCG 1 cut(s) 220
Ppu21I YACGTR 1 cut(s) 67
PpuMI RGGWCCY 1 cut(s) 183
Psp5II RGGWCCY 1 cut(s) 183
PspPI GGNCC 1 cut(s) 183
PspPPI RGGWCCY 1 cut(s) 183
PvuI CGATCG 1 cut(s) 220
RsaI GTAC 2 cut(s) 71, 157
RsaNI GTAC 2 cut(s) 70, 156
RseI CAYNNNNRTG 1 cut(s) 65
SalI GTCGAC 1 cut(s) 25
SapI GCTCTTC 1 cut(s) 50
SaqAI TTAA 2 cut(s) 12, 92
Sau3AI GATC 1 cut(s) 217
Sau96I GGNCC 1 cut(s) 183
SetI ASST 3 cut(s) 69, 188, 211
SfcI CTRYAG 1 cut(s) 174
SinI GGWCC 1 cut(s) 183
SmiMI CAYNNNNRTG 1 cut(s) 65
Sse9I AATT 2 cut(s) 77, 169
SspI AATATT 1 cut(s) 45
SspMI CTAG 1 cut(s) 6
StyI CCWWGG 1 cut(s) 33
TaiI ACGT 1 cut(s) 69
TaqI TCGA 2 cut(s) 26, 211
TasI AATT 2 cut(s) 77, 169
TatI WGTACW 1 cut(s) 155
Tru1I TTAA 2 cut(s) 12, 92
Tru9I TTAA 2 cut(s) 12, 92
VpaK11BI GGWCC 1 cut(s) 183
XapI RAATTY 1 cut(s) 77
XmiI GTMKAC 1 cut(s) 26
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.