Prupe.8G107200_v2.0.a1

C1 domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0024529
Physical Location & Seq
Reverse (-)
13822160 .. 13825297
3138 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G107200.2

Sequence Viewer

Length: 759 bp
ATGAAAATCGTGGTTGGCCTAATAAAACGTAGGTCGACAGCAGCCGCCATGACGAAATTCGATGAGATACCGCACCCGAGCCACCCAGAACACAAGCTGGAGCAGAGATGGACAGGGAAGCTGTTCATGTGCAACGGGTGCAATGAGCCAGGCATAGGTTCACACTACACGTGTCCCCAATCCTCATGCAGCTTTGATCTGCACATGTACTGTGCCATTCCCTTGGGCCTTTTCCACCACCCCTTCCAACGCGGTTGCAGCTTCCAACTCCTCCCAAGCCCACCGGAGAACACTCGCAGCTGCAATGCATGCGGGGAGAAAGGAACGGGGTTCGTGTACCATTGCAGAGGCTGCAAGTCCAACCTCCACCCCTGCTGTGCTAAGCTGCCCATGAAGCTCGAGGCTGGAGATGTCAACCTCTATTTGTATGAAAAAGTGAAAAAACCGTGCCAAGAATGTGGATATAAAGGGAAGGGCTGGAGTTATAGGTCCGTGGACAAGAAATGTTATCTGCATGTGGCATGTGCGAAGAAATTGATAGCAGAAAAATGGCTACATGGCTCGGGACATGGTGATGATTTGCAGACCACAATTCCAAACCTCAACAACATGATTCAAAAGTACCATCAACCTAAAGGGAAGCTGAAGAGGTTCGCTGAGATTGTCCGGTTGGTTTTGCAGACGGTGATATCAACTCTGCTAGGTGATCCAACGGCTTTGATTGCTGGAACTGTCAAGTTGCTATTGACAGATGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
C1_2

Protein Analysis

253

Amino Acids

28.16

Weight (kDa)

9.06

Isoelectric Point (pI)

37.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024529)

Species Orthologous Gene IDs
prunus_persica Prupe.8G107200_v2.0.a1 Prupe.8G107200_v2.0.a1
pyrus_communis pycom05g06270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 35
AccII CGCG 1 cut(s) 252
AciI CCGC 4 cut(s) 45, 71, 252, 312
AclWI GGATC 1 cut(s) 701
AcsI RAATTY 1 cut(s) 56
AcuI CTGAAG 1 cut(s) 665
AcvI CACGTG 1 cut(s) 171
AfaI GTAC 3 cut(s) 209, 338, 623
AfiI CCNNNNNNNGG 1 cut(s) 155
AflIII ACRYGT 3 cut(s) 168, 170, 204
AgsI TTSAA 1 cut(s) 617
AjnI CCWGG 1 cut(s) 148
AluBI AGCT 8 cut(s) 97, 121, 192, 261, 300, 385, 397, 643
AluI AGCT 8 cut(s) 97, 121, 192, 261, 300, 385, 397, 643
AlwI GGATC 1 cut(s) 701
AlwNI CAGNNNCTG 1 cut(s) 351
Ama87I CYCGRG 3 cut(s) 76, 398, 562
AoxI GGCC 2 cut(s) 16, 226
ApeKI GCWGC 7 cut(s) 41, 189, 258, 297, 300, 351, 385
ApoI RAATTY 1 cut(s) 56
Asp700I GAANNNNTTC 2 cut(s) 122, 650
AspS9I GGNCC 2 cut(s) 226, 489
AsuHPI GGTGA 3 cut(s) 584, 697, 716
AvaI CYCGRG 3 cut(s) 76, 398, 562
AvaII GGWCC 1 cut(s) 489
BbrPI CACGTG 1 cut(s) 171
BbvI GCAGC 7 cut(s) 53, 201, 270, 287, 309, 338, 372
BccI CCATC 2 cut(s) 102, 633
BceAI ACGGC 1 cut(s) 729
BciT130I CCWGG 1 cut(s) 150
BfaI CTAG 1 cut(s) 701
BisI GCNGC 8 cut(s) 42, 45, 190, 259, 298, 301, 352, 386
BlpI GCTNAGC 1 cut(s) 381
BlsI GCNGC 8 cut(s) 43, 46, 191, 260, 299, 302, 353, 387
Bme1390I CCNGG 1 cut(s) 150
Bme18I GGWCC 1 cut(s) 489
BmeT110I CYCGRG 3 cut(s) 76, 398, 562
BmgT120I GGNCC 2 cut(s) 226, 489
BmrFI CCNGG 1 cut(s) 150
BpmI CTGGAG 3 cut(s) 119, 426, 499
Bpu1102I GCTNAGC 1 cut(s) 381
BsaAI YACGTR 1 cut(s) 171
BsaJI CCNNGG 2 cut(s) 222, 492
BsaWI WCCGGW 2 cut(s) 283, 666
Bsc4I CCNNNNNNNGG 1 cut(s) 155
Bse3DI GCAATG 3 cut(s) 148, 310, 340
BseBI CCWGG 1 cut(s) 150
BseDI CCNNGG 2 cut(s) 222, 492
BseLI CCNNNNNNNGG 1 cut(s) 155
BseMI GCAATG 3 cut(s) 148, 310, 340
BseMII CTCAG 1 cut(s) 648
BseRI GAGGAG 1 cut(s) 260
BseXI GCAGC 7 cut(s) 53, 201, 270, 287, 309, 338, 372
BsgI GTGCAG 1 cut(s) 185
Bsh1236I CGCG 1 cut(s) 252
BshFI GGCC 2 cut(s) 18, 228
BsiHKCI CYCGRG 3 cut(s) 76, 398, 562
BsiSI CCGG 2 cut(s) 284, 667
BslFI GGGAC 2 cut(s) 159, 579
BslI CCNNNNNNNGG 1 cut(s) 155
BsmFI GGGAC 2 cut(s) 159, 579
BsnI GGCC 2 cut(s) 18, 228
BsoBI CYCGRG 3 cut(s) 76, 398, 562
Bsp143I GATC 2 cut(s) 196, 706
Bsp1720I GCTNAGC 1 cut(s) 381
BspACI CCGC 4 cut(s) 45, 71, 252, 312
BspANI GGCC 2 cut(s) 18, 228
BspCNI CTCAG 1 cut(s) 649
BspFNI CGCG 1 cut(s) 252
BspPI GGATC 1 cut(s) 701
BsrDI GCAATG 3 cut(s) 148, 310, 340
BssECI CCNNGG 2 cut(s) 222, 492
BssMI GATC 2 cut(s) 196, 706
BssT1I CCWWGG 1 cut(s) 222
Bst2UI CCWGG 1 cut(s) 150
Bst4CI ACNGT 4 cut(s) 212, 447, 685, 733
Bst6I CTCTTC 1 cut(s) 641
BstAPI GCANNNNNTGC 3 cut(s) 138, 309, 351
BstBAI YACGTR 1 cut(s) 171
BstC8I GCNNGC 1 cut(s) 310
BstDEI CTNAG 2 cut(s) 381, 657
BstDSI CCRYGG 1 cut(s) 492
BstFNI CGCG 1 cut(s) 252
BstKTI GATC 2 cut(s) 199, 709
BstMBI GATC 2 cut(s) 196, 706
BstMWI GCNNNNNNNGC 6 cut(s) 138, 258, 309, 351, 394, 722
BstNI CCWGG 1 cut(s) 150
BstNSI RCATGY 4 cut(s) 208, 312, 518, 525
BstSCI CCNGG 1 cut(s) 148
BstUI CGCG 1 cut(s) 252
BstV1I GCAGC 7 cut(s) 53, 201, 270, 287, 309, 338, 372
BstXI CCANNNNNNTGG 2 cut(s) 223, 458
BsuRI GGCC 2 cut(s) 18, 228
BtgI CCRYGG 1 cut(s) 492
Cac8I GCNNGC 1 cut(s) 310
CaiI CAGNNNCTG 1 cut(s) 351
Cfr13I GGNCC 2 cut(s) 226, 489
Csp6I GTAC 3 cut(s) 208, 337, 622
CviQI GTAC 3 cut(s) 208, 337, 622
DdeI CTNAG 2 cut(s) 381, 657
DpnI GATC 2 cut(s) 198, 708
DpnII GATC 2 cut(s) 196, 706
Eam1104I CTCTTC 1 cut(s) 641
EarI CTCTTC 1 cut(s) 641
Eco130I CCWWGG 1 cut(s) 222
Eco32I GATATC 1 cut(s) 690
Eco47I GGWCC 1 cut(s) 489
Eco57I CTGAAG 1 cut(s) 665
Eco72I CACGTG 1 cut(s) 171
Eco88I CYCGRG 3 cut(s) 76, 398, 562
EcoRII CCWGG 1 cut(s) 148
EcoRV GATATC 1 cut(s) 690
EcoT14I CCWWGG 1 cut(s) 222
EcoT22I ATGCAT 1 cut(s) 310
ErhI CCWWGG 1 cut(s) 222
FaqI GGGAC 2 cut(s) 159, 579
FauI CCCGC 1 cut(s) 305
FblI GTMKAC 1 cut(s) 35
Fnu4HI GCNGC 8 cut(s) 42, 45, 190, 259, 298, 301, 352, 386
Fsp4HI GCNGC 8 cut(s) 42, 45, 190, 259, 298, 301, 352, 386
FspBI CTAG 1 cut(s) 701
GluI GCNGC 8 cut(s) 42, 45, 190, 259, 298, 301, 352, 386
GsuI CTGGAG 3 cut(s) 119, 426, 499
HaeIII GGCC 2 cut(s) 18, 228
HapII CCGG 2 cut(s) 284, 667
HincII GTYRAC 2 cut(s) 36, 415
HindII GTYRAC 2 cut(s) 36, 415
HinfI GANTC 1 cut(s) 613
HpaII CCGG 2 cut(s) 284, 667
HphI GGTGA 3 cut(s) 584, 697, 716
Hpy166II GTNNAC 5 cut(s) 36, 161, 337, 415, 496
Hpy188III TCNNGA 1 cut(s) 564
Hpy8I GTNNAC 5 cut(s) 36, 161, 337, 415, 496
HpyAV CCTTC 2 cut(s) 253, 466
HpyCH4III ACNGT 4 cut(s) 212, 447, 685, 733
HpyCH4IV ACGT 2 cut(s) 28, 170
HpyF10VI GCNNNNNNNGC 6 cut(s) 138, 258, 309, 351, 394, 722
HpyF3I CTNAG 2 cut(s) 381, 657
HpySE526I ACGT 2 cut(s) 28, 170
Kzo9I GATC 2 cut(s) 196, 706
LmnI GCTCC 1 cut(s) 100
Lsp1109I GCAGC 7 cut(s) 53, 201, 270, 287, 309, 338, 372
MaeI CTAG 1 cut(s) 701
MaeII ACGT 2 cut(s) 28, 170
MalI GATC 2 cut(s) 198, 708
MboI GATC 2 cut(s) 196, 706
MboII GAAGA 2 cut(s) 541, 658
MluCI AATT 3 cut(s) 56, 533, 591
MmeI TCCRAC 4 cut(s) 271, 289, 384, 734
MnlI CCTC 8 cut(s) 193, 281, 341, 374, 394, 428, 611, 642
Mph1103I ATGCAT 1 cut(s) 310
MroXI GAANNNNTTC 2 cut(s) 122, 650
MslI CAYNNNNRTG 1 cut(s) 573
MspA1I CMGCKG 1 cut(s) 300
MspI CCGG 2 cut(s) 284, 667
MspR9I CCNGG 1 cut(s) 150
MvaI CCWGG 1 cut(s) 150
MvnI CGCG 1 cut(s) 252
MwoI GCNNNNNNNGC 6 cut(s) 138, 258, 309, 351, 394, 722
NdeII GATC 2 cut(s) 196, 706
NsiI ATGCAT 1 cut(s) 310
NspI RCATGY 4 cut(s) 208, 312, 518, 525
PaeI GCATGC 1 cut(s) 312
PaeR7I CTCGAG 1 cut(s) 398
PciI ACATGT 1 cut(s) 204
PdmI GAANNNNTTC 2 cut(s) 122, 650
PfeI GAWTC 1 cut(s) 613
PkrI GCNGC 8 cut(s) 43, 46, 191, 260, 299, 302, 353, 387
PmaCI CACGTG 1 cut(s) 171
PmlI CACGTG 1 cut(s) 171
Ppu21I YACGTR 1 cut(s) 171
PscI ACATGT 1 cut(s) 204
Psp6I CCWGG 1 cut(s) 148
PspCI CACGTG 1 cut(s) 171
PspGI CCWGG 1 cut(s) 148
PspPI GGNCC 2 cut(s) 226, 489
PspXI VCTCGAGB 1 cut(s) 398
PstNI CAGNNNCTG 1 cut(s) 351
PvuII CAGCTG 1 cut(s) 300
RsaI GTAC 3 cut(s) 209, 338, 623
RsaNI GTAC 3 cut(s) 208, 337, 622
RseI CAYNNNNRTG 1 cut(s) 573
SalI GTCGAC 1 cut(s) 34
SatI GCNGC 8 cut(s) 42, 45, 190, 259, 298, 301, 352, 386
Sau3AI GATC 2 cut(s) 196, 706
Sau96I GGNCC 2 cut(s) 226, 489
ScrFI CCNGG 1 cut(s) 150
Sfr274I CTCGAG 1 cut(s) 398
SinI GGWCC 1 cut(s) 489
SlaI CTCGAG 1 cut(s) 398
SmiMI CAYNNNNRTG 1 cut(s) 573
SmlI CTYRAG 1 cut(s) 398
SmoI CTYRAG 1 cut(s) 398
SphI GCATGC 1 cut(s) 312
Sse9I AATT 3 cut(s) 56, 533, 591
SsiI CCGC 4 cut(s) 45, 71, 252, 312
SspMI CTAG 1 cut(s) 701
StyD4I CCNGG 1 cut(s) 148
StyI CCWWGG 1 cut(s) 222
TaaI ACNGT 4 cut(s) 212, 447, 685, 733
TaiI ACGT 2 cut(s) 31, 173
TaqI TCGA 3 cut(s) 35, 60, 399
TasI AATT 3 cut(s) 56, 533, 591
TatI WGTACW 1 cut(s) 207
TauI GCSGC 1 cut(s) 47
TfiI GAWTC 1 cut(s) 613
TseI GCWGC 7 cut(s) 41, 189, 258, 297, 300, 351, 385
TspDTI ATGAA 4 cut(s) 17, 115, 407, 444
TspGWI ACGGA 1 cut(s) 481
VpaK11BI GGWCC 1 cut(s) 489
XapI RAATTY 1 cut(s) 56
XceI RCATGY 4 cut(s) 208, 312, 518, 525
XhoI CTCGAG 1 cut(s) 398
XmiI GTMKAC 1 cut(s) 35
XmnI GAANNNNTTC 2 cut(s) 122, 650
XspI CTAG 1 cut(s) 701
Zsp2I ATGCAT 1 cut(s) 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.