pycom01g15790

Thaumatin family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0028614
Physical Location & Seq
Reverse (-)
15561589 .. 15561951
363 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 363 bp
ATGATGCTCGGAACCTCAAACTCCGCCTTGCATTACTACAATGTGAGTTTGATTGACGGATTCAACGTGCCAGCTTCAATGAGGCCAATAGGTGGTAGTGGGTGTGGAGTTGCTGCCTGTGAGGCTGACTTGAACGTTTGCTGCTGCTTGCCTTGGTGGTCAAGAAACAAGGTAGGGTGCAAGAGCGCTTGCTTCGCCGGAAATCGGACCGGTATTGCTGCAGAGGGGAGTTTGCAGATCCAGAGAGTTGCAAGCCTACTATTTTTGGGCATCCTTTCAAGGCTATTTGTCCTAGAGCTTATAGTTATGCCTTTGATGATTCTACAGGGCTTAAGATTTGTACGGCTCCTAGGTATGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Thaumatin

Protein Analysis

121

Amino Acids

12.86

Weight (kDa)

8.82

Isoelectric Point (pI)

47.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Thaumatin PF00314 3 - 70 4.9e-12 Thaumatin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0028614)

Species Orthologous Gene IDs
malus_domestica MD01G1137000.v1.1
pyrus_communis pycom01g15790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 92
AciI CCGC 1 cut(s) 24
AclI AACGTT 1 cut(s) 135
AclWI GGATC 1 cut(s) 232
AfaI GTAC 1 cut(s) 342
AfeI AGCGCT 1 cut(s) 187
AfiI CCNNNNNNNGG 2 cut(s) 92, 204
AflII CTTAAG 1 cut(s) 331
AgeI ACCGGT 1 cut(s) 209
AgsI TTSAA 4 cut(s) 64, 78, 133, 279
AluBI AGCT 2 cut(s) 74, 298
AluI AGCT 2 cut(s) 74, 298
AlwI GGATC 1 cut(s) 232
Aor51HI AGCGCT 1 cut(s) 187
AoxI GGCC 1 cut(s) 83
ApeKI GCWGC 4 cut(s) 113, 141, 144, 218
AsiGI ACCGGT 1 cut(s) 209
AspA2I CCTAGG 1 cut(s) 349
AspLEI GCGC 1 cut(s) 188
AspS9I GGNCC 1 cut(s) 207
AvaII GGWCC 1 cut(s) 207
AvrII CCTAGG 1 cut(s) 349
BbvI GCAGC 4 cut(s) 100, 128, 131, 205
BceAI ACGGC 1 cut(s) 359
BfaI CTAG 2 cut(s) 293, 350
BfmI CTRYAG 2 cut(s) 219, 323
BfoI RGCGCY 1 cut(s) 189
BfrI CTTAAG 1 cut(s) 331
BglI GCCNNNNNGGC 1 cut(s) 122
BisI GCNGC 4 cut(s) 114, 142, 145, 219
BlnI CCTAGG 1 cut(s) 349
BlsI GCNGC 4 cut(s) 115, 143, 146, 220
Bme18I GGWCC 1 cut(s) 207
BmgT120I GGNCC 1 cut(s) 207
BmiI GGNNCC 2 cut(s) 13, 347
BmsI GCATC 1 cut(s) 279
BsaJI CCNNGG 2 cut(s) 152, 349
BsaWI WCCGGW 1 cut(s) 209
Bsc4I CCNNNNNNNGG 2 cut(s) 92, 204
Bse118I RCCGGY 1 cut(s) 209
BseDI CCNNGG 2 cut(s) 152, 349
BseGI GGATG 1 cut(s) 270
BseLI CCNNNNNNNGG 2 cut(s) 92, 204
BseXI GCAGC 4 cut(s) 100, 128, 131, 205
BshFI GGCC 1 cut(s) 85
BshTI ACCGGT 1 cut(s) 209
BsiSI CCGG 2 cut(s) 198, 210
BslI CCNNNNNNNGG 2 cut(s) 92, 204
BsnI GGCC 1 cut(s) 85
Bsp143I GATC 1 cut(s) 237
BspACI CCGC 1 cut(s) 24
BspANI GGCC 1 cut(s) 85
BspLI GGNNCC 2 cut(s) 13, 347
BspMAI CTGCAG 1 cut(s) 223
BspPI GGATC 1 cut(s) 232
BspTI CTTAAG 1 cut(s) 331
BsrFI RCCGGY 1 cut(s) 209
BssAI RCCGGY 1 cut(s) 209
BssECI CCNNGG 2 cut(s) 152, 349
BssMI GATC 1 cut(s) 237
BssT1I CCWWGG 2 cut(s) 152, 349
BstAFI CTTAAG 1 cut(s) 331
BstC8I GCNNGC 4 cut(s) 72, 149, 190, 253
BstF5I GGATG 1 cut(s) 270
BstH2I RGCGCY 1 cut(s) 189
BstHHI GCGC 1 cut(s) 188
BstKTI GATC 1 cut(s) 240
BstMBI GATC 1 cut(s) 237
BstMWI GCNNNNNNNGC 2 cut(s) 122, 194
BstSFI CTRYAG 2 cut(s) 219, 323
BstV1I GCAGC 4 cut(s) 100, 128, 131, 205
BstX2I RGATCY 1 cut(s) 237
BstYI RGATCY 1 cut(s) 237
BsuRI GGCC 1 cut(s) 85
BtsCI GGATG 1 cut(s) 270
Cac8I GCNNGC 4 cut(s) 72, 149, 190, 253
CfoI GCGC 1 cut(s) 188
Cfr10I RCCGGY 1 cut(s) 209
Cfr13I GGNCC 1 cut(s) 207
CpoI CGGWCCG 1 cut(s) 207
Csp6I GTAC 1 cut(s) 341
CspAI ACCGGT 1 cut(s) 209
CspI CGGWCCG 1 cut(s) 207
CviJI RGCY 8 cut(s) 74, 85, 125, 255, 283, 298, 330, 346
CviKI_1 RGCY 8 cut(s) 74, 85, 125, 255, 283, 298, 330, 346
CviQI GTAC 1 cut(s) 341
DpnI GATC 1 cut(s) 239
DpnII GATC 1 cut(s) 237
EciI GGCGGA 1 cut(s) 13
Eco130I CCWWGG 2 cut(s) 152, 349
Eco47I GGWCC 1 cut(s) 207
Eco47III AGCGCT 1 cut(s) 187
EcoT14I CCWWGG 2 cut(s) 152, 349
ErhI CCWWGG 2 cut(s) 152, 349
FaiI YATR 4 cut(s) 302, 308, 356, 361
Fnu4HI GCNGC 4 cut(s) 114, 142, 145, 219
FokI GGATG 1 cut(s) 257
Fsp4HI GCNGC 4 cut(s) 114, 142, 145, 219
FspBI CTAG 2 cut(s) 293, 350
GlaI GCGC 1 cut(s) 187
GluI GCNGC 4 cut(s) 114, 142, 145, 219
HaeII RGCGCY 1 cut(s) 189
HaeIII GGCC 1 cut(s) 85
HapII CCGG 2 cut(s) 198, 210
HhaI GCGC 1 cut(s) 188
Hin6I GCGC 1 cut(s) 186
HinP1I GCGC 1 cut(s) 186
HinfI GANTC 2 cut(s) 60, 319
HpaII CCGG 2 cut(s) 198, 210
Hpy188I TCNGA 2 cut(s) 11, 207
Hpy188III TCNNGA 2 cut(s) 162, 241
HpyCH4IV ACGT 2 cut(s) 66, 135
HpyCH4V TGCA 5 cut(s) 31, 180, 221, 235, 251
HpyF10VI GCNNNNNNNGC 2 cut(s) 122, 194
HpySE526I ACGT 2 cut(s) 66, 135
HspAI GCGC 1 cut(s) 186
Kzo9I GATC 1 cut(s) 237
LmnI GCTCC 1 cut(s) 351
LpnPI CCDG 6 cut(s) 84, 130, 211, 223, 254, 311
Lsp1109I GCAGC 4 cut(s) 100, 128, 131, 205
LweI GCATC 1 cut(s) 279
MaeI CTAG 2 cut(s) 293, 350
MaeII ACGT 2 cut(s) 66, 135
MalI GATC 1 cut(s) 239
MboI GATC 1 cut(s) 237
MflI RGATCY 1 cut(s) 237
MnlI CCTC 4 cut(s) 25, 75, 115, 217
MseI TTAA 1 cut(s) 332
MspCI CTTAAG 1 cut(s) 331
MspI CCGG 2 cut(s) 198, 210
MwoI GCNNNNNNNGC 2 cut(s) 122, 194
NdeII GATC 1 cut(s) 237
NlaIV GGNNCC 2 cut(s) 13, 347
PcsI WCGNNNNNNNCGW 1 cut(s) 63
PfeI GAWTC 2 cut(s) 60, 319
PflMI CCANNNNNTGG 1 cut(s) 92
PinAI ACCGGT 1 cut(s) 209
PkrI GCNGC 4 cut(s) 115, 143, 146, 220
Psp1406I AACGTT 1 cut(s) 135
PspN4I GGNNCC 2 cut(s) 13, 347
PspPI GGNCC 1 cut(s) 207
PstI CTGCAG 1 cut(s) 223
PsuI RGATCY 1 cut(s) 237
RsaI GTAC 1 cut(s) 342
RsaNI GTAC 1 cut(s) 341
Rsr2I CGGWCCG 1 cut(s) 207
RsrII CGGWCCG 1 cut(s) 207
SaqAI TTAA 1 cut(s) 332
SatI GCNGC 4 cut(s) 114, 142, 145, 219
Sau3AI GATC 1 cut(s) 237
Sau96I GGNCC 1 cut(s) 207
SetI ASST 8 cut(s) 17, 69, 76, 94, 138, 174, 300, 355
SfaNI GCATC 1 cut(s) 279
SfcI CTRYAG 2 cut(s) 219, 323
SinI GGWCC 1 cut(s) 207
SmlI CTYRAG 1 cut(s) 331
SmoI CTYRAG 1 cut(s) 331
SsiI CCGC 1 cut(s) 24
SspMI CTAG 2 cut(s) 293, 350
StyI CCWWGG 2 cut(s) 152, 349
TaiI ACGT 2 cut(s) 69, 138
TfiI GAWTC 2 cut(s) 60, 319
Tru1I TTAA 1 cut(s) 332
Tru9I TTAA 1 cut(s) 332
TseI GCWGC 4 cut(s) 113, 141, 144, 218
TspGWI ACGGA 1 cut(s) 72
Van91I CCANNNNNTGG 1 cut(s) 92
Vha464I CTTAAG 1 cut(s) 331
VpaK11BI GGWCC 1 cut(s) 207
XmaJI CCTAGG 1 cut(s) 349
XspI CTAG 2 cut(s) 293, 350
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.