pycom01g15850

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0029032
Physical Location & Seq
Forward (+)
15587919 .. 15588149
231 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 231 bp
ATGGCCTCCAGATCATCAAACTCACCCCCCAATCTGTGGTCCACAACTTCAAGAATTAAACCGGCCATCCACTTCTCCCAAACCCAATCAACCAAAATCAGCTCCTCCGGCTGGGCTTTTGGTTCAATGGGTCTCCTCCCACACACCAGCTCCAGCAGGAGAGCACCAAGAGCAAACACATCCGAGCTCGGAGTCGGTTTTCCGGTCCGAGTCAACTCCGGAGCGAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.09

Weight (kDa)

12.0

Isoelectric Point (pI)

70.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029032)

Species Orthologous Gene IDs
prunus_persica Prupe.6G260100_v2.0.a1
pyrus_communis pycom01g15850

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 36
AccIII TCCGGA 1 cut(s) 218
AcoI YGGCCR 1 cut(s) 63
AfiI CCNNNNNNNGG 3 cut(s) 36, 111, 225
AgsI TTSAA 2 cut(s) 51, 126
AluBI AGCT 3 cut(s) 102, 150, 187
AluI AGCT 3 cut(s) 102, 150, 187
Alw21I GWGCWC 2 cut(s) 166, 189
Alw26I GTCTC 1 cut(s) 137
Aor13HI TCCGGA 1 cut(s) 218
AoxI GGCC 2 cut(s) 3, 63
AspS9I GGNCC 2 cut(s) 39, 205
AsuHPI GGTGA 1 cut(s) 15
AvaII GGWCC 2 cut(s) 39, 205
BanII GRGCYC 1 cut(s) 189
Bbv12I GWGCWC 2 cut(s) 166, 189
BccI CCATC 1 cut(s) 74
BcoDI GTCTC 1 cut(s) 137
Bme18I GGWCC 2 cut(s) 39, 205
BmgT120I GGNCC 2 cut(s) 39, 205
BpmI CTGGAG 1 cut(s) 136
BsaI GGTCTC 1 cut(s) 137
BsaWI WCCGGW 2 cut(s) 202, 218
BsaXI ACNNNNNCTCC 2 cut(s) 134, 164
Bsc4I CCNNNNNNNGG 3 cut(s) 36, 111, 225
Bse118I RCCGGY 1 cut(s) 61
BseAI TCCGGA 1 cut(s) 218
BseGI GGATG 2 cut(s) 66, 179
BseLI CCNNNNNNNGG 3 cut(s) 36, 111, 225
BseRI GAGGAG 2 cut(s) 94, 125
BseYI CCCAGC 1 cut(s) 111
BshFI GGCC 2 cut(s) 5, 65
BsiHKAI GWGCWC 2 cut(s) 166, 189
BsiSI CCGG 4 cut(s) 62, 108, 203, 219
BslI CCNNNNNNNGG 3 cut(s) 36, 111, 225
BsmAI GTCTC 1 cut(s) 137
BsnI GGCC 2 cut(s) 5, 65
Bso31I GGTCTC 1 cut(s) 137
Bsp1286I GDGCHC 2 cut(s) 166, 189
Bsp13I TCCGGA 1 cut(s) 218
Bsp143I GATC 1 cut(s) 11
BspANI GGCC 2 cut(s) 5, 65
BspEI TCCGGA 1 cut(s) 218
BspTNI GGTCTC 1 cut(s) 137
BsrFI RCCGGY 1 cut(s) 61
BssAI RCCGGY 1 cut(s) 61
BssMI GATC 1 cut(s) 11
BstF5I GGATG 2 cut(s) 66, 179
BstKTI GATC 1 cut(s) 14
BstMAI GTCTC 1 cut(s) 137
BstMBI GATC 1 cut(s) 11
BstMWI GCNNNNNNNGC 2 cut(s) 108, 170
BsuRI GGCC 2 cut(s) 5, 65
BtsCI GGATG 2 cut(s) 66, 179
Cfr10I RCCGGY 1 cut(s) 61
Cfr13I GGNCC 2 cut(s) 39, 205
CpoI CGGWCCG 1 cut(s) 205
CspI CGGWCCG 1 cut(s) 205
CviJI RGCY 7 cut(s) 5, 65, 102, 111, 116, 150, 187
CviKI_1 RGCY 7 cut(s) 5, 65, 102, 111, 116, 150, 187
DpnI GATC 1 cut(s) 13
DpnII GATC 1 cut(s) 11
EaeI YGGCCR 1 cut(s) 63
Ecl136II GAGCTC 1 cut(s) 187
Eco24I GRGCYC 1 cut(s) 189
Eco31I GGTCTC 1 cut(s) 137
Eco47I GGWCC 2 cut(s) 39, 205
Eco53kI GAGCTC 1 cut(s) 187
EcoICRI GAGCTC 1 cut(s) 187
EcoT38I GRGCYC 1 cut(s) 189
FokI GGATG 2 cut(s) 53, 166
FriOI GRGCYC 1 cut(s) 189
GsaI CCCAGC 1 cut(s) 115
GsuI CTGGAG 1 cut(s) 136
HaeIII GGCC 2 cut(s) 5, 65
HapII CCGG 4 cut(s) 62, 108, 203, 219
HincII GTYRAC 1 cut(s) 214
HindII GTYRAC 1 cut(s) 214
HinfI GANTC 2 cut(s) 192, 210
HpaII CCGG 4 cut(s) 62, 108, 203, 219
HphI GGTGA 1 cut(s) 15
Hpy166II GTNNAC 2 cut(s) 42, 214
Hpy188I TCNGA 3 cut(s) 184, 191, 209
Hpy188III TCNNGA 3 cut(s) 9, 51, 219
Hpy8I GTNNAC 2 cut(s) 42, 214
HpyF10VI GCNNNNNNNGC 2 cut(s) 108, 170
Kpn2I TCCGGA 1 cut(s) 218
Kzo9I GATC 1 cut(s) 11
LmnI GCTCC 3 cut(s) 107, 155, 221
LpnPI CCDG 8 cut(s) 22, 75, 97, 121, 142, 160, 166, 216
MalI GATC 1 cut(s) 13
MboI GATC 1 cut(s) 11
MhlI GDGCHC 2 cut(s) 166, 189
MluCI AATT 1 cut(s) 54
MlyI GAGTC 2 cut(s) 201, 219
MnlI CCTC 4 cut(s) 16, 115, 146, 219
MroI TCCGGA 1 cut(s) 218
MseI TTAA 1 cut(s) 57
MspI CCGG 4 cut(s) 62, 108, 203, 219
MwoI GCNNNNNNNGC 2 cut(s) 108, 170
NdeII GATC 1 cut(s) 11
PflMI CCANNNNNTGG 1 cut(s) 36
PleI GAGTC 2 cut(s) 200, 218
PpsI GAGTC 2 cut(s) 200, 218
Psp124BI GAGCTC 1 cut(s) 189
PspFI CCCAGC 1 cut(s) 111
PspPI GGNCC 2 cut(s) 39, 205
Rsr2I CGGWCCG 1 cut(s) 205
RsrII CGGWCCG 1 cut(s) 205
SacI GAGCTC 1 cut(s) 189
SaqAI TTAA 1 cut(s) 57
Sau3AI GATC 1 cut(s) 11
Sau96I GGNCC 2 cut(s) 39, 205
SchI GAGTC 2 cut(s) 201, 219
SduI GDGCHC 2 cut(s) 166, 189
SetI ASST 4 cut(s) 104, 152, 189, 230
SinI GGWCC 2 cut(s) 39, 205
Sse9I AATT 1 cut(s) 54
SstI GAGCTC 1 cut(s) 189
TasI AATT 1 cut(s) 54
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
Van91I CCANNNNNTGG 1 cut(s) 36
VpaK11BI GGWCC 2 cut(s) 39, 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.