pycom01g18470

Coiled-coil domain-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
17453725 .. 17458951
5227 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g18470.2

Sequence Viewer

Length: 258 bp
ATGGCCAAGATGGAAAAAATTGTCATTTCGCTGGATTTGTCAAAGGTCGGCGAGAAGATTCTGAGCTCCATTAGGTGTGCCAGGTCGCTCGGCCTTCTTCCTTGTGCTTCTGCTCGCCCCGAGGTGATTGAAATTTCAGTGATGACATCGACAGTGTTGACATCATGGACATGGGGTTGTAGTTTGTCAACTATTTCCAGGCCAATAGTTTATAACTATCGCCCATCTGTTTTGTTGAGGTATTTTTCATTTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.52

Weight (kDa)

9.51

Isoelectric Point (pI)

33.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029200)

Species Orthologous Gene IDs
pyrus_communis pycom01g18470 pycom13g21960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 213
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 132
AgsI TTSAA 1 cut(s) 131
AjnI CCWGG 2 cut(s) 80, 197
AluBI AGCT 1 cut(s) 66
AluI AGCT 1 cut(s) 66
Alw21I GWGCWC 1 cut(s) 68
Ama87I CYCGRG 1 cut(s) 119
AoxI GGCC 3 cut(s) 3, 91, 200
ApoI RAATTY 1 cut(s) 132
AsuHPI GGTGA 1 cut(s) 136
AvaI CYCGRG 1 cut(s) 119
BalI TGGCCA 1 cut(s) 5
BanII GRGCYC 1 cut(s) 68
Bbv12I GWGCWC 1 cut(s) 68
BccI CCATC 2 cut(s) 4, 232
BciT130I CCWGG 2 cut(s) 82, 199
Bme1390I CCNGG 2 cut(s) 82, 199
BmeT110I CYCGRG 1 cut(s) 119
BmrFI CCNGG 2 cut(s) 82, 199
BsaJI CCNNGG 1 cut(s) 120
BseBI CCWGG 2 cut(s) 82, 199
BseDI CCNNGG 1 cut(s) 120
BseMII CTCAG 1 cut(s) 53
BshFI GGCC 3 cut(s) 5, 93, 202
BsiHKAI GWGCWC 1 cut(s) 68
BsiHKCI CYCGRG 1 cut(s) 119
BsnI GGCC 3 cut(s) 5, 93, 202
BsoBI CYCGRG 1 cut(s) 119
Bsp1286I GDGCHC 1 cut(s) 68
BspANI GGCC 3 cut(s) 5, 93, 202
BspCNI CTCAG 1 cut(s) 54
BssECI CCNNGG 1 cut(s) 120
Bst2UI CCWGG 2 cut(s) 82, 199
Bst4CI ACNGT 1 cut(s) 154
BstC8I GCNNGC 1 cut(s) 115
BstDEI CTNAG 1 cut(s) 62
BstNI CCWGG 2 cut(s) 82, 199
BstSCI CCNGG 2 cut(s) 80, 197
BsuRI GGCC 3 cut(s) 5, 93, 202
BtsIMutI CAGTG 2 cut(s) 144, 159
Cac8I GCNNGC 1 cut(s) 115
CviAII CATG 2 cut(s) 165, 171
CviJI RGCY 4 cut(s) 5, 66, 93, 202
CviKI_1 RGCY 4 cut(s) 5, 66, 93, 202
DdeI CTNAG 1 cut(s) 62
EaeI YGGCCR 1 cut(s) 3
Ecl136II GAGCTC 1 cut(s) 66
Eco24I GRGCYC 1 cut(s) 68
Eco53kI GAGCTC 1 cut(s) 66
Eco88I CYCGRG 1 cut(s) 119
EcoICRI GAGCTC 1 cut(s) 66
EcoRII CCWGG 2 cut(s) 80, 197
EcoT38I GRGCYC 1 cut(s) 68
FaeI CATG 2 cut(s) 168, 174
FaiI YATR 3 cut(s) 166, 172, 213
FatI CATG 2 cut(s) 164, 170
FriOI GRGCYC 1 cut(s) 68
HaeIII GGCC 3 cut(s) 5, 93, 202
Hin1II CATG 2 cut(s) 168, 174
HincII GTYRAC 2 cut(s) 159, 189
HindII GTYRAC 2 cut(s) 159, 189
HinfI GANTC 1 cut(s) 58
HphI GGTGA 1 cut(s) 136
Hpy166II GTNNAC 2 cut(s) 159, 189
Hpy188I TCNGA 1 cut(s) 63
Hpy8I GTNNAC 2 cut(s) 159, 189
HpyAV CCTTC 1 cut(s) 104
HpyCH4III ACNGT 1 cut(s) 154
HpyF3I CTNAG 1 cut(s) 62
Hsp92II CATG 2 cut(s) 168, 174
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 5 cut(s) 17, 67, 94, 184, 211
MboII GAAGA 2 cut(s) 67, 89
MhlI GDGCHC 1 cut(s) 68
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 18, 132
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 2 cut(s) 115, 231
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 256
MslI CAYNNNNRTG 1 cut(s) 169
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 2 cut(s) 82, 199
MvaI CCWGG 2 cut(s) 82, 199
NlaIII CATG 2 cut(s) 168, 174
NmeAIII GCCGAG 1 cut(s) 69
PfeI GAWTC 1 cut(s) 58
PsiI TTATAA 1 cut(s) 213
Psp124BI GAGCTC 1 cut(s) 68
Psp6I CCWGG 2 cut(s) 80, 197
PspGI CCWGG 2 cut(s) 80, 197
RseI CAYNNNNRTG 1 cut(s) 169
SacI GAGCTC 1 cut(s) 68
SaqAI TTAA 1 cut(s) 256
ScrFI CCNGG 2 cut(s) 82, 199
SduI GDGCHC 1 cut(s) 68
SetI ASST 6 cut(s) 48, 68, 77, 86, 126, 242
SmiMI CAYNNNNRTG 1 cut(s) 169
Sse9I AATT 2 cut(s) 18, 132
SstI GAGCTC 1 cut(s) 68
StyD4I CCNGG 2 cut(s) 80, 197
TaaI ACNGT 1 cut(s) 154
TaqI TCGA 1 cut(s) 149
TasI AATT 2 cut(s) 18, 132
TfiI GAWTC 1 cut(s) 58
Tru1I TTAA 1 cut(s) 256
Tru9I TTAA 1 cut(s) 256
TscAI CASTG 2 cut(s) 144, 159
TspDTI ATGAA 1 cut(s) 237
TspRI CASTG 2 cut(s) 144, 159
XapI RAATTY 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.