pycom02g23460

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Forward (+)
21546236 .. 21547031
796 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g23460.2

Sequence Viewer

Length: 234 bp
ATGAAGTCTTCAACTCGGCTGGACTCGGCTCTGTTCCAACTCACCCCAACTCGGACCAGGTGCGATCTGGTTATATCCGCAAATGGAATGACGGAGAAAATAGCTTCTGGTTTGTTGAATCCGTTTCTGTCCCACTTGAAGACTGCGCAAGAACAAATGGCCAAGGGTGGTTATTCAATTATTCTTGAGCCTATGTTTAACATAACAAAGTTGAAGTTAGATTCCATCATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.52

Weight (kDa)

9.36

Isoelectric Point (pI)

32.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024622)

Species Orthologous Gene IDs
pyrus_communis pycom02g23460 pycom14g05330
rosa_roxburghii Rroxscaffold_1G00028040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 147
AciI CCGC 1 cut(s) 78
AcoI YGGCCR 1 cut(s) 159
AfiI CCNNNNNNNGG 1 cut(s) 51
AgsI TTSAA 5 cut(s) 12, 118, 139, 177, 214
AjnI CCWGG 1 cut(s) 56
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
AoxI GGCC 1 cut(s) 159
AspLEI GCGC 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 54
AsuHPI GGTGA 1 cut(s) 34
AvaII GGWCC 1 cut(s) 54
BalI TGGCCA 1 cut(s) 161
BbsI GAAGAC 1 cut(s) 146
BccI CCATC 1 cut(s) 233
BciT130I CCWGG 1 cut(s) 58
Bme1390I CCNGG 1 cut(s) 58
Bme18I GGWCC 1 cut(s) 54
BmgT120I GGNCC 1 cut(s) 54
BmrFI CCNGG 1 cut(s) 58
BpiI GAAGAC 1 cut(s) 146
BpuEI CTTGAG 1 cut(s) 206
BsaJI CCNNGG 1 cut(s) 162
Bsc4I CCNNNNNNNGG 1 cut(s) 51
BseBI CCWGG 1 cut(s) 58
BseDI CCNNGG 1 cut(s) 162
BseLI CCNNNNNNNGG 1 cut(s) 51
BshFI GGCC 1 cut(s) 161
BslFI GGGAC 1 cut(s) 115
BslI CCNNNNNNNGG 1 cut(s) 51
BsmFI GGGAC 1 cut(s) 115
BsnI GGCC 1 cut(s) 161
Bsp143I GATC 1 cut(s) 64
BspACI CCGC 1 cut(s) 78
BspANI GGCC 1 cut(s) 161
BssECI CCNNGG 1 cut(s) 162
BssMI GATC 1 cut(s) 64
BssT1I CCWWGG 1 cut(s) 162
Bst2UI CCWGG 1 cut(s) 58
BstHHI GCGC 1 cut(s) 148
BstKTI GATC 1 cut(s) 67
BstMBI GATC 1 cut(s) 64
BstNI CCWGG 1 cut(s) 58
BstSCI CCNGG 1 cut(s) 56
BstV2I GAAGAC 1 cut(s) 146
BsuRI GGCC 1 cut(s) 161
CfoI GCGC 1 cut(s) 148
Cfr13I GGNCC 1 cut(s) 54
CsiI ACCWGGT 1 cut(s) 56
CviAII CATG 1 cut(s) 229
CviJI RGCY 5 cut(s) 19, 29, 104, 161, 190
CviKI_1 RGCY 5 cut(s) 19, 29, 104, 161, 190
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
EaeI YGGCCR 1 cut(s) 159
Eco130I CCWWGG 1 cut(s) 162
Eco47I GGWCC 1 cut(s) 54
EcoRII CCWGG 1 cut(s) 56
EcoT14I CCWWGG 1 cut(s) 162
ErhI CCWWGG 1 cut(s) 162
FaeI CATG 1 cut(s) 232
FaiI YATR 4 cut(s) 74, 194, 203, 230
FaqI GGGAC 1 cut(s) 115
FatI CATG 1 cut(s) 228
FspI TGCGCA 1 cut(s) 147
GlaI GCGC 1 cut(s) 147
HaeIII GGCC 1 cut(s) 161
HhaI GCGC 1 cut(s) 148
Hin1II CATG 1 cut(s) 232
Hin6I GCGC 1 cut(s) 146
HinP1I GCGC 1 cut(s) 146
HinfI GANTC 3 cut(s) 23, 118, 221
HphI GGTGA 1 cut(s) 34
Hpy188I TCNGA 1 cut(s) 54
Hpy188III TCNNGA 1 cut(s) 185
Hsp92II CATG 1 cut(s) 232
HspAI GCGC 1 cut(s) 146
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 5 cut(s) 5, 43, 53, 70, 93
MabI ACCWGGT 1 cut(s) 56
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 1 cut(s) 151
MlsI TGGCCA 1 cut(s) 161
MluCI AATT 1 cut(s) 177
MluNI TGGCCA 1 cut(s) 161
MlyI GAGTC 1 cut(s) 17
MmeI TCCRAC 1 cut(s) 61
Mox20I TGGCCA 1 cut(s) 161
MscI TGGCCA 1 cut(s) 161
MseI TTAA 1 cut(s) 198
Msp20I TGGCCA 1 cut(s) 161
MspR9I CCNGG 1 cut(s) 58
MvaI CCWGG 1 cut(s) 58
NdeII GATC 1 cut(s) 64
NlaIII CATG 1 cut(s) 232
NmeAIII GCCGAG 1 cut(s) 5
NsbI TGCGCA 1 cut(s) 147
PfeI GAWTC 2 cut(s) 118, 221
PleI GAGTC 1 cut(s) 17
PpsI GAGTC 1 cut(s) 17
Psp6I CCWGG 1 cut(s) 56
PspGI CCWGG 1 cut(s) 56
PspPI GGNCC 1 cut(s) 54
SaqAI TTAA 1 cut(s) 198
Sau3AI GATC 1 cut(s) 64
Sau96I GGNCC 1 cut(s) 54
SchI GAGTC 1 cut(s) 17
ScrFI CCNGG 1 cut(s) 58
SetI ASST 2 cut(s) 62, 106
SexAI ACCWGGT 1 cut(s) 56
SinI GGWCC 1 cut(s) 54
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
Sse9I AATT 1 cut(s) 177
SsiI CCGC 1 cut(s) 78
StyD4I CCNGG 1 cut(s) 56
StyI CCWWGG 1 cut(s) 162
TasI AATT 1 cut(s) 177
TfiI GAWTC 2 cut(s) 118, 221
Tru1I TTAA 1 cut(s) 198
Tru9I TTAA 1 cut(s) 198
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 2 cut(s) 107, 111
VpaK11BI GGWCC 1 cut(s) 54
XcmI CCANNNNNNNNNTGG 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.