pycom04g04970
NAC Family

Inactive beta-amylase 4

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0029236
Physical Location & Seq
Forward (+)
4627007 .. 4627307
301 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 219 bp
ATGTTATCTTCATTTGCTAAGAAATTTGAATCCTTAATTGGAACTGTGATAGAAGAAATTAGTGTTGCCAGTCCAATGATTTCTTATGCAACATTGTTACATTGCTCACACAGATATCCTACACATCCTTTTGGTGATGGTAGATGGAAGTTTCCTGGAATCGGTGAATTCCAGTGCTATGACAAGTGCATGTATGCTATAAATCTTTCATTCCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00500 map00500
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.18

Weight (kDa)

6.8

Isoelectric Point (pI)

59.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_14 PF01373 2 - 64 1.3e-11 Glycosyl hydrolase family 14
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029236)

Species Orthologous Gene IDs
pyrus_communis pycom03g13670 pycom04g04970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 23, 167
AfiI CCNNNNNNNGG 1 cut(s) 161
AgsI TTSAA 1 cut(s) 29
AjnI CCWGG 1 cut(s) 154
AjuI GAANNNNNNNTTGG 2 cut(s) 21, 53
ApoI RAATTY 2 cut(s) 23, 167
AsuHPI GGTGA 2 cut(s) 146, 176
BccI CCATC 2 cut(s) 131, 138
BciT130I CCWGG 1 cut(s) 156
Bme1390I CCNGG 1 cut(s) 156
BmrFI CCNGG 1 cut(s) 156
Bsc4I CCNNNNNNNGG 1 cut(s) 161
Bse1I ACTGG 2 cut(s) 69, 172
Bse3DI GCAATG 1 cut(s) 100
BseBI CCWGG 1 cut(s) 156
BseGI GGATG 1 cut(s) 124
BseLI CCNNNNNNNGG 1 cut(s) 161
BseMI GCAATG 1 cut(s) 100
BseNI ACTGG 2 cut(s) 69, 172
BslI CCNNNNNNNGG 1 cut(s) 161
BsrDI GCAATG 1 cut(s) 100
BsrI ACTGG 2 cut(s) 69, 172
Bst2UI CCWGG 1 cut(s) 156
Bst4CI ACNGT 1 cut(s) 46
BstDEI CTNAG 1 cut(s) 18
BstF5I GGATG 1 cut(s) 124
BstNI CCWGG 1 cut(s) 156
BstNSI RCATGY 1 cut(s) 193
BstSCI CCNGG 1 cut(s) 154
BtsCI GGATG 1 cut(s) 124
BtsIMutI CAGTG 1 cut(s) 179
CviAII CATG 1 cut(s) 190
DdeI CTNAG 1 cut(s) 18
Eco32I GATATC 1 cut(s) 116
EcoRI GAATTC 1 cut(s) 167
EcoRII CCWGG 1 cut(s) 154
EcoRV GATATC 1 cut(s) 116
FaeI CATG 1 cut(s) 193
FaiI YATR 5 cut(s) 87, 180, 191, 195, 200
FatI CATG 1 cut(s) 189
FokI GGATG 1 cut(s) 111
Hin1II CATG 1 cut(s) 193
HinfI GANTC 2 cut(s) 29, 159
HphI GGTGA 2 cut(s) 146, 176
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4V TGCA 2 cut(s) 89, 189
HpyF3I CTNAG 1 cut(s) 18
Hsp92II CATG 1 cut(s) 193
LpnPI CCDG 4 cut(s) 82, 141, 168, 185
MaeIII GTNAC 1 cut(s) 96
MboII GAAGA 1 cut(s) 65
MluCI AATT 4 cut(s) 23, 36, 57, 167
MseI TTAA 1 cut(s) 35
MslI CAYNNNNRTG 1 cut(s) 214
MspR9I CCNGG 1 cut(s) 156
MvaI CCWGG 1 cut(s) 156
NlaIII CATG 1 cut(s) 193
NspI RCATGY 1 cut(s) 193
PfeI GAWTC 2 cut(s) 29, 159
PfoI TCCNGGA 1 cut(s) 154
Psp6I CCWGG 1 cut(s) 154
PspGI CCWGG 1 cut(s) 154
RseI CAYNNNNRTG 1 cut(s) 214
SaqAI TTAA 1 cut(s) 35
ScrFI CCNGG 1 cut(s) 156
SgeI CNNG 6 cut(s) 81, 167, 168, 184, 196, 202
SmiMI CAYNNNNRTG 1 cut(s) 214
Sse9I AATT 4 cut(s) 23, 36, 57, 167
StyD4I CCNGG 1 cut(s) 154
TaaI ACNGT 1 cut(s) 46
TasI AATT 4 cut(s) 23, 36, 57, 167
TfiI GAWTC 2 cut(s) 29, 159
Tru1I TTAA 1 cut(s) 35
Tru9I TTAA 1 cut(s) 35
TscAI CASTG 1 cut(s) 179
TspDTI ATGAA 1 cut(s) 198
TspRI CASTG 1 cut(s) 179
XapI RAATTY 2 cut(s) 23, 167
XceI RCATGY 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.