pycom05g06270

C1 domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0024529
Physical Location & Seq
Reverse (-)
8359666 .. 8360400
735 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 735 bp
ATGACGAAATTCGACGAGGTAACGCACCCGAACCACTCAGAACACAAGCTCAATGAGAGTTGGACAGACAAGCTGTTCCAGTGCAATGGCTGCAACGAACCAGGCATAGGTTCACATTACACATGTCCCCACCCCAGATGCAACTTCGATCTCCACATTTCCTGTGCCATCTCTTCCGGTCCTTTTCTTTCCGTCCACCACCCCTTCCAACGTAAGTGCAAATTTGAACTCCGCCCAAGCTCATCGGGTAAAGCTCAACGTTGCGAAGCATGCCGAGAGGATGCAACAGGATATGTTTACCACTGCCAGGGCCGCTGCAAATCCATCCTCCACCCCTGCTGTGCGAAGCTACCAATGGACCTCAAGGCTGGGGATGTCAGCCTCTCTTTGTGCAGGAAACCAAAAAAGTCGTGCCAAAAGTGTGGACATAAAGGAAAGGGCTGGAGTTATAGGTCTGCAGATGGGAATTGTAATTTGCACGTCGGATGCGCCAAGGAATTGATAGCAGAGAATTGGCTTCATGGCTTGGGACATGGGGGGAGCGATGGCAGAATATCGCAGACCACGATTCCAAACCTGAACAACATGATTCAGACATACAGCCGCCCTAACGGTAGACTGAGAAGATTCACTGAGACTGCTCTGTTGGTCTTGAAAATTGTTATATCGGCGGTGCTAGGTGATCCGTCGGCTTTAATTGCTGAGACTGTCAAGTTGCTCTTGACAGATGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
C1_2

Protein Analysis

245

Amino Acids

26.96

Weight (kDa)

8.89

Isoelectric Point (pI)

28.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
C1_2 PF03107 11 - 56 1.2e-06 C1 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024529)

Species Orthologous Gene IDs
prunus_persica Prupe.8G107200_v2.0.a1 Prupe.8G107200_v2.0.a1
pyrus_communis pycom05g06270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 616
AciI CCGC 4 cut(s) 232, 313, 604, 671
AclI AACGTT 1 cut(s) 259
AclWI GGATC 1 cut(s) 677
AcsI RAATTY 2 cut(s) 8, 221
AfiI CCNNNNNNNGG 2 cut(s) 107, 307
AflIII ACRYGT 1 cut(s) 122
AgsI TTSAA 2 cut(s) 227, 655
AjiI CACGTC 1 cut(s) 481
AjnI CCWGG 2 cut(s) 100, 306
AluBI AGCT 5 cut(s) 49, 73, 240, 254, 349
AluI AGCT 5 cut(s) 49, 73, 240, 254, 349
Alw26I GTCTC 2 cut(s) 629, 698
AlwI GGATC 1 cut(s) 677
AoxI GGCC 1 cut(s) 310
ApeKI GCWGC 2 cut(s) 90, 315
ApoI RAATTY 2 cut(s) 8, 221
AspLEI GCGC 1 cut(s) 491
AspS9I GGNCC 3 cut(s) 179, 310, 358
AsuHPI GGTGA 1 cut(s) 692
AvaII GGWCC 2 cut(s) 179, 358
BbvI GCAGC 2 cut(s) 77, 302
BccI CCATC 4 cut(s) 176, 332, 455, 539
BciT130I CCWGG 2 cut(s) 102, 308
BcoDI GTCTC 2 cut(s) 629, 698
BfaI CTAG 2 cut(s) 677, 733
BfmI CTRYAG 1 cut(s) 456
BisI GCNGC 4 cut(s) 91, 313, 316, 604
BlsI GCNGC 4 cut(s) 92, 314, 317, 605
Bme1390I CCNGG 2 cut(s) 102, 308
Bme18I GGWCC 2 cut(s) 179, 358
BmgBI CACGTC 1 cut(s) 481
BmgT120I GGNCC 3 cut(s) 179, 310, 358
BmrFI CCNGG 2 cut(s) 102, 308
BmsI GCATC 4 cut(s) 128, 271, 476, 718
BpmI CTGGAG 1 cut(s) 463
BpuEI CTTGAG 1 cut(s) 347
BsaJI CCNNGG 2 cut(s) 307, 492
BsaWI WCCGGW 1 cut(s) 176
Bsc4I CCNNNNNNNGG 2 cut(s) 107, 307
Bse1I ACTGG 1 cut(s) 79
Bse3DI GCAATG 1 cut(s) 91
BseBI CCWGG 2 cut(s) 102, 308
BseDI CCNNGG 2 cut(s) 307, 492
BseGI GGATG 4 cut(s) 286, 324, 379, 491
BseLI CCNNNNNNNGG 2 cut(s) 107, 307
BseMI GCAATG 1 cut(s) 91
BseMII CTCAG 4 cut(s) 51, 611, 624, 693
BseNI ACTGG 1 cut(s) 79
BseXI GCAGC 2 cut(s) 77, 302
BseYI CCCAGC 1 cut(s) 368
BsgI GTGCAG 1 cut(s) 412
BshFI GGCC 1 cut(s) 312
BsiSI CCGG 1 cut(s) 177
BslFI GGGAC 2 cut(s) 111, 543
BslI CCNNNNNNNGG 2 cut(s) 107, 307
BsmAI GTCTC 2 cut(s) 629, 698
BsmFI GGGAC 2 cut(s) 111, 543
BsnI GGCC 1 cut(s) 312
Bsp143I GATC 2 cut(s) 148, 682
BspACI CCGC 4 cut(s) 232, 313, 604, 671
BspANI GGCC 1 cut(s) 312
BspCNI CTCAG 4 cut(s) 50, 612, 625, 694
BspMAI CTGCAG 1 cut(s) 460
BspPI GGATC 1 cut(s) 677
BsrDI GCAATG 1 cut(s) 91
BsrI ACTGG 1 cut(s) 79
BssECI CCNNGG 2 cut(s) 307, 492
BssMI GATC 2 cut(s) 148, 682
BssT1I CCWWGG 1 cut(s) 492
Bst2UI CCWGG 2 cut(s) 102, 308
Bst4CI ACNGT 2 cut(s) 614, 709
Bst6I CTCTTC 1 cut(s) 178
BstAPI GCANNNNNTGC 1 cut(s) 90
BstC8I GCNNGC 1 cut(s) 271
BstDEI CTNAG 4 cut(s) 37, 620, 633, 702
BstF5I GGATG 4 cut(s) 286, 324, 379, 491
BstHHI GCGC 1 cut(s) 491
BstKTI GATC 2 cut(s) 151, 685
BstMAI GTCTC 2 cut(s) 629, 698
BstMBI GATC 2 cut(s) 148, 682
BstMWI GCNNNNNNNGC 4 cut(s) 90, 270, 312, 698
BstNI CCWGG 2 cut(s) 102, 308
BstNSI RCATGY 2 cut(s) 126, 273
BstSCI CCNGG 2 cut(s) 100, 306
BstSFI CTRYAG 1 cut(s) 456
BstV1I GCAGC 2 cut(s) 77, 302
BstXI CCANNNNNNTGG 2 cut(s) 86, 422
BsuRI GGCC 1 cut(s) 312
BtgZI GCGATG 1 cut(s) 558
BtrI CACGTC 1 cut(s) 481
BtsCI GGATG 4 cut(s) 286, 324, 379, 491
BtsI GCAGTG 1 cut(s) 301
BtsIMutI CAGTG 3 cut(s) 86, 301, 630
Cac8I GCNNGC 1 cut(s) 271
CfoI GCGC 1 cut(s) 491
Cfr13I GGNCC 3 cut(s) 179, 310, 358
CviAII CATG 5 cut(s) 123, 270, 521, 533, 586
DdeI CTNAG 4 cut(s) 37, 620, 633, 702
DpnI GATC 2 cut(s) 150, 684
DpnII GATC 2 cut(s) 148, 682
Eam1104I CTCTTC 1 cut(s) 178
EarI CTCTTC 1 cut(s) 178
EciI GGCGGA 1 cut(s) 221
Eco130I CCWWGG 1 cut(s) 492
Eco47I GGWCC 2 cut(s) 179, 358
EcoRII CCWGG 2 cut(s) 100, 306
EcoT14I CCWWGG 1 cut(s) 492
ErhI CCWWGG 1 cut(s) 492
FaeI CATG 5 cut(s) 126, 273, 524, 536, 589
FalI AAGNNNNNCTT 1 cut(s) 704
FaqI GGGAC 2 cut(s) 111, 543
FatI CATG 5 cut(s) 122, 269, 520, 532, 585
FblI GTMKAC 1 cut(s) 616
Fnu4HI GCNGC 4 cut(s) 91, 313, 316, 604
FokI GGATG 4 cut(s) 293, 311, 386, 498
Fsp4HI GCNGC 4 cut(s) 91, 313, 316, 604
FspBI CTAG 2 cut(s) 677, 733
GlaI GCGC 1 cut(s) 490
GluI GCNGC 4 cut(s) 91, 313, 316, 604
GsaI CCCAGC 1 cut(s) 372
GsuI CTGGAG 1 cut(s) 463
HaeIII GGCC 1 cut(s) 312
HapII CCGG 1 cut(s) 177
HhaI GCGC 1 cut(s) 491
Hin1II CATG 5 cut(s) 126, 273, 524, 536, 589
Hin6I GCGC 1 cut(s) 489
HinP1I GCGC 1 cut(s) 489
HinfI GANTC 3 cut(s) 568, 589, 627
HpaII CCGG 1 cut(s) 177
HphI GGTGA 1 cut(s) 692
Hpy166II GTNNAC 5 cut(s) 113, 196, 298, 425, 617
Hpy188I TCNGA 3 cut(s) 40, 485, 594
Hpy188III TCNNGA 2 cut(s) 652, 721
Hpy8I GTNNAC 5 cut(s) 113, 196, 298, 425, 617
Hpy99I CGWCG 3 cut(s) 17, 485, 691
HpyAV CCTTC 1 cut(s) 214
HpyCH4III ACNGT 2 cut(s) 614, 709
HpyCH4IV ACGT 3 cut(s) 211, 259, 480
HpyCH4V TGCA 9 cut(s) 84, 93, 141, 219, 284, 318, 393, 458, 478
HpyF10VI GCNNNNNNNGC 4 cut(s) 90, 270, 312, 698
HpyF3I CTNAG 4 cut(s) 37, 620, 633, 702
HpySE526I ACGT 3 cut(s) 211, 259, 480
Hsp92II CATG 5 cut(s) 126, 273, 524, 536, 589
HspAI GCGC 1 cut(s) 489
Kzo9I GATC 2 cut(s) 148, 682
LmnI GCTCC 1 cut(s) 540
Lsp1109I GCAGC 2 cut(s) 77, 302
LweI GCATC 4 cut(s) 128, 271, 476, 718
MaeI CTAG 2 cut(s) 677, 733
MaeII ACGT 3 cut(s) 211, 259, 480
MaeIII GTNAC 1 cut(s) 19
MalI GATC 2 cut(s) 150, 684
MboI GATC 2 cut(s) 148, 682
MboII GAAGA 2 cut(s) 165, 636
MluCI AATT 8 cut(s) 8, 221, 466, 472, 497, 511, 657, 696
MmeI TCCRAC 3 cut(s) 41, 232, 463
MnlI CCTC 5 cut(s) 10, 271, 338, 371, 392
MseI TTAA 1 cut(s) 695
MspA1I CMGCKG 1 cut(s) 315
MspI CCGG 1 cut(s) 177
MspR9I CCNGG 2 cut(s) 102, 308
MvaI CCWGG 2 cut(s) 102, 308
MwoI GCNNNNNNNGC 4 cut(s) 90, 270, 312, 698
NdeII GATC 2 cut(s) 148, 682
NlaIII CATG 5 cut(s) 126, 273, 524, 536, 589
NmeAIII GCCGAG 1 cut(s) 299
NspI RCATGY 2 cut(s) 126, 273
PaeI GCATGC 1 cut(s) 273
PciI ACATGT 1 cut(s) 122
PcsI WCGNNNNNNNCGW 1 cut(s) 563
PfeI GAWTC 3 cut(s) 568, 589, 627
PkrI GCNGC 4 cut(s) 92, 314, 317, 605
PscI ACATGT 1 cut(s) 122
Psp1406I AACGTT 1 cut(s) 259
Psp6I CCWGG 2 cut(s) 100, 306
PspFI CCCAGC 1 cut(s) 368
PspGI CCWGG 2 cut(s) 100, 306
PspPI GGNCC 3 cut(s) 179, 310, 358
PstI CTGCAG 1 cut(s) 460
SaqAI TTAA 1 cut(s) 695
SatI GCNGC 4 cut(s) 91, 313, 316, 604
Sau3AI GATC 2 cut(s) 148, 682
Sau96I GGNCC 3 cut(s) 179, 310, 358
ScrFI CCNGG 2 cut(s) 102, 308
SfaNI GCATC 4 cut(s) 128, 271, 476, 718
SfcI CTRYAG 1 cut(s) 456
SinI GGWCC 2 cut(s) 179, 358
SmlI CTYRAG 1 cut(s) 362
SmoI CTYRAG 1 cut(s) 362
SphI GCATGC 1 cut(s) 273
Sse9I AATT 8 cut(s) 8, 221, 466, 472, 497, 511, 657, 696
SsiI CCGC 4 cut(s) 232, 313, 604, 671
SspMI CTAG 2 cut(s) 677, 733
StyD4I CCNGG 2 cut(s) 100, 306
StyI CCWWGG 1 cut(s) 492
TaaI ACNGT 2 cut(s) 614, 709
TaiI ACGT 3 cut(s) 214, 262, 483
TaqI TCGA 2 cut(s) 12, 147
TasI AATT 8 cut(s) 8, 221, 466, 472, 497, 511, 657, 696
TauI GCSGC 2 cut(s) 315, 606
TfiI GAWTC 3 cut(s) 568, 589, 627
Tru1I TTAA 1 cut(s) 695
Tru9I TTAA 1 cut(s) 695
TscAI CASTG 3 cut(s) 86, 308, 637
TseI GCWGC 2 cut(s) 90, 315
TspDTI ATGAA 1 cut(s) 509
TspGWI ACGGA 2 cut(s) 181, 675
TspRI CASTG 3 cut(s) 86, 308, 637
VpaK11BI GGWCC 2 cut(s) 179, 358
XapI RAATTY 2 cut(s) 8, 221
XceI RCATGY 2 cut(s) 126, 273
XmiI GTMKAC 1 cut(s) 616
XspI CTAG 2 cut(s) 677, 733
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.