pycom08g12050

Belongs to the glycosyl hydrolase 1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0029349
Physical Location & Seq
Forward (+)
10326791 .. 10327447
657 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 351 bp
ATGTCGCACGTAAAGGACCAAGTGTGTGGGATAACTACAATGAGAAGTTTCCAGAGGATTCAGGACCATTCCAATCTGTCTATTGCCACCGATTCGTATAGGCGATACAAGGAAGATGTGGTGGCTATGAAGAACCTTGGAGTCGATGCCAACAGATTTTCTATTGCCTGGACCAGGATTCTTCCTAGTAAGAACTTTAATGAAAATAATGGCTTTAAACATGTAGACGGAAGCTTGAATGGTGGAATAAATCAAGAGGGCCTTGATCACCACAACAACGTGATCGATGAATTACTGAAGAATGGTAAGACACTTAATTTTACAAAGAACAGTGACAGTATATCTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00460 ko00500 ko00940 ko01100 ko01110 map00460 map00500 map00940 map01100 map01110
Pfam Domains
Protein Families
Glyco_hydro_1

Protein Analysis

117

Amino Acids

13.07

Weight (kDa)

7.93

Isoelectric Point (pI)

21.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_1 PF00232 17 - 102 1.3e-16 Glycosyl hydrolase family 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029349)

Species Orthologous Gene IDs
pyrus_communis pycom08g12050
rosa_multiflora Rmu_sc0017957.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 225
AcuI CTGAAG 1 cut(s) 317
AfiI CCNNNNNNNGG 1 cut(s) 174
AflIII ACRYGT 1 cut(s) 220
AgsI TTSAA 1 cut(s) 238
AjnI CCWGG 2 cut(s) 167, 173
AluBI AGCT 1 cut(s) 234
AluI AGCT 1 cut(s) 234
AoxI GGCC 1 cut(s) 259
AspS9I GGNCC 4 cut(s) 16, 64, 171, 259
AsuHPI GGTGA 1 cut(s) 260
AvaII GGWCC 3 cut(s) 16, 64, 171
BciT130I CCWGG 2 cut(s) 169, 175
BclI TGATCA 1 cut(s) 265
BfaI CTAG 1 cut(s) 186
Bme1390I CCNGG 2 cut(s) 169, 175
Bme18I GGWCC 3 cut(s) 16, 64, 171
BmgT120I GGNCC 4 cut(s) 16, 64, 171, 259
BmrFI CCNGG 2 cut(s) 169, 175
BmsI GCATC 1 cut(s) 136
Bsa29I ATCGAT 1 cut(s) 285
BsaAI YACGTR 1 cut(s) 10
BsaJI CCNNGG 1 cut(s) 136
Bsc4I CCNNNNNNNGG 1 cut(s) 174
BseBI CCWGG 2 cut(s) 169, 175
BseCI ATCGAT 1 cut(s) 285
BseDI CCNNGG 1 cut(s) 136
BseLI CCNNNNNNNGG 1 cut(s) 174
BshFI GGCC 1 cut(s) 261
BshVI ATCGAT 1 cut(s) 285
BslI CCNNNNNNNGG 1 cut(s) 174
BsnI GGCC 1 cut(s) 261
Bsp143I GATC 2 cut(s) 265, 282
BspANI GGCC 1 cut(s) 261
BspDI ATCGAT 1 cut(s) 285
BssECI CCNNGG 1 cut(s) 136
BssMI GATC 2 cut(s) 265, 282
BssT1I CCWWGG 1 cut(s) 136
Bst2UI CCWGG 2 cut(s) 169, 175
Bst4CI ACNGT 2 cut(s) 332, 338
BstBAI YACGTR 1 cut(s) 10
BstENI CCTNNNNNAGG 1 cut(s) 172
BstKTI GATC 2 cut(s) 268, 285
BstMBI GATC 2 cut(s) 265, 282
BstNI CCWGG 2 cut(s) 169, 175
BstNSI RCATGY 1 cut(s) 224
BstSCI CCNGG 2 cut(s) 167, 173
BstXI CCANNNNNNTGG 1 cut(s) 26
Bsu15I ATCGAT 1 cut(s) 285
BsuRI GGCC 1 cut(s) 261
BsuTUI ATCGAT 1 cut(s) 285
BtsIMutI CAGTG 1 cut(s) 337
Cfr13I GGNCC 4 cut(s) 16, 64, 171, 259
ClaI ATCGAT 1 cut(s) 285
CviAII CATG 1 cut(s) 221
CviJI RGCY 4 cut(s) 125, 213, 234, 261
CviKI_1 RGCY 4 cut(s) 125, 213, 234, 261
DpnI GATC 2 cut(s) 267, 284
DpnII GATC 2 cut(s) 265, 282
DraI TTTAAA 1 cut(s) 217
Eco130I CCWWGG 1 cut(s) 136
Eco47I GGWCC 3 cut(s) 16, 64, 171
Eco57I CTGAAG 1 cut(s) 317
EcoNI CCTNNNNNAGG 1 cut(s) 172
EcoO109I RGGNCCY 1 cut(s) 259
EcoRII CCWGG 2 cut(s) 167, 173
EcoT14I CCWWGG 1 cut(s) 136
ErhI CCWWGG 1 cut(s) 136
FaeI CATG 1 cut(s) 224
FaiI YATR 5 cut(s) 99, 128, 222, 341, 349
FalI AAGNNNNNCTT 2 cut(s) 246, 278
FatI CATG 1 cut(s) 220
FbaI TGATCA 1 cut(s) 265
FblI GTMKAC 1 cut(s) 225
FspBI CTAG 1 cut(s) 186
HaeIII GGCC 1 cut(s) 261
Hin1II CATG 1 cut(s) 224
HindIII AAGCTT 1 cut(s) 232
HinfI GANTC 4 cut(s) 58, 92, 141, 178
HphI GGTGA 1 cut(s) 260
Hpy166II GTNNAC 1 cut(s) 226
Hpy188III TCNNGA 3 cut(s) 52, 62, 254
Hpy8I GTNNAC 1 cut(s) 226
HpyCH4III ACNGT 2 cut(s) 332, 338
HpyCH4IV ACGT 2 cut(s) 9, 279
HpySE526I ACGT 2 cut(s) 9, 279
Hsp92II CATG 1 cut(s) 224
Ksp22I TGATCA 1 cut(s) 265
Kzo9I GATC 2 cut(s) 265, 282
LpnPI CCDG 6 cut(s) 47, 65, 154, 160, 181, 187
LweI GCATC 1 cut(s) 136
MaeI CTAG 1 cut(s) 186
MaeII ACGT 2 cut(s) 9, 279
MaeIII GTNAC 1 cut(s) 332
MalI GATC 2 cut(s) 267, 284
MboI GATC 2 cut(s) 265, 282
MboII GAAGA 5 cut(s) 125, 142, 173, 310, 336
MluCI AATT 2 cut(s) 290, 316
MlyI GAGTC 1 cut(s) 150
MnlI CCTC 2 cut(s) 48, 250
MseI TTAA 3 cut(s) 198, 216, 315
MspR9I CCNGG 2 cut(s) 169, 175
MvaI CCWGG 2 cut(s) 169, 175
NdeII GATC 2 cut(s) 265, 282
NlaIII CATG 1 cut(s) 224
NmuCI GTSAC 1 cut(s) 332
NspI RCATGY 1 cut(s) 224
PciI ACATGT 1 cut(s) 220
PfeI GAWTC 3 cut(s) 58, 92, 178
PleI GAGTC 1 cut(s) 149
PpsI GAGTC 1 cut(s) 149
Ppu21I YACGTR 1 cut(s) 10
PscI ACATGT 1 cut(s) 220
Psp6I CCWGG 2 cut(s) 167, 173
PspGI CCWGG 2 cut(s) 167, 173
PspPI GGNCC 4 cut(s) 16, 64, 171, 259
SaqAI TTAA 3 cut(s) 198, 216, 315
Sau3AI GATC 2 cut(s) 265, 282
Sau96I GGNCC 4 cut(s) 16, 64, 171, 259
SchI GAGTC 1 cut(s) 150
ScrFI CCNGG 2 cut(s) 169, 175
SetI ASST 4 cut(s) 12, 138, 236, 282
SfaNI GCATC 1 cut(s) 136
SinI GGWCC 3 cut(s) 16, 64, 171
Sse9I AATT 2 cut(s) 290, 316
SspMI CTAG 1 cut(s) 186
StyD4I CCNGG 2 cut(s) 167, 173
StyI CCWWGG 1 cut(s) 136
TaaI ACNGT 2 cut(s) 332, 338
TaiI ACGT 2 cut(s) 12, 282
TaqI TCGA 2 cut(s) 144, 285
TasI AATT 2 cut(s) 290, 316
TfiI GAWTC 3 cut(s) 58, 92, 178
Tru1I TTAA 3 cut(s) 198, 216, 315
Tru9I TTAA 3 cut(s) 198, 216, 315
TscAI CASTG 1 cut(s) 337
TseFI GTSAC 1 cut(s) 332
Tsp45I GTSAC 1 cut(s) 332
TspDTI ATGAA 4 cut(s) 143, 216, 303, 336
TspGWI ACGGA 1 cut(s) 243
TspRI CASTG 1 cut(s) 337
VpaK11BI GGWCC 3 cut(s) 16, 64, 171
XagI CCTNNNNNAGG 1 cut(s) 172
XceI RCATGY 1 cut(s) 224
XmiI GTMKAC 1 cut(s) 225
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.