pycom09g02470

PAN-like domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
1844946 .. 1845215
270 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGTGGAATTTTCTTCCGCTTCCAGGGATTTTGCCTAAAAATCAAGAAGTAGCCATAAAAAGGTTGTCCAAGAAGTCAGGGCAAGGGCTTCAGGAGTTCATGAATGAGTTGAAGCTTATAGCCAAGCTCCAACATACCAATCTTGTTCGGCTCTTGGGTTGCGCTATTGGAGACGAGCAACTGCTACTTATCTATAAGTTCATGTCGAATCGTAGTTTGGACGAGTTTTTGTTTGGTATGTTCTCGGCACTTTTCAGATTACTTCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

90

Amino Acids

10.25

Weight (kDa)

9.58

Isoelectric Point (pI)

37.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 13 - 77 1.6e-12 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 13 - 77 3e-08 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029359)

Species Orthologous Gene IDs
pyrus_communis pycom09g02470
rosa_chinensis RchiOBHm_Chr2g0160881

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 17
AcsI RAATTY 1 cut(s) 7
AcuI CTGAAG 1 cut(s) 74
AfiI CCNNNNNNNGG 2 cut(s) 23, 60
AgsI TTSAA 1 cut(s) 112
AjnI CCWGG 1 cut(s) 22
AjuI GAANNNNNNNTTGG 2 cut(s) 200, 232
AluBI AGCT 2 cut(s) 115, 127
AluI AGCT 2 cut(s) 115, 127
Alw26I GTCTC 1 cut(s) 165
ApoI RAATTY 1 cut(s) 7
AspLEI GCGC 1 cut(s) 164
BciT130I CCWGG 1 cut(s) 24
BcoDI GTCTC 1 cut(s) 165
Bme1390I CCNGG 1 cut(s) 24
BmrFI CCNGG 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 23
Bsc4I CCNNNNNNNGG 2 cut(s) 23, 60
BseBI CCWGG 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 23
BseLI CCNNNNNNNGG 2 cut(s) 23, 60
BslI CCNNNNNNNGG 2 cut(s) 23, 60
BsmAI GTCTC 1 cut(s) 165
BsmBI CGTCTC 1 cut(s) 165
BspACI CCGC 1 cut(s) 17
BspHI TCATGA 1 cut(s) 99
BssECI CCNNGG 1 cut(s) 23
Bst2UI CCWGG 1 cut(s) 24
BstHHI GCGC 1 cut(s) 164
BstMAI GTCTC 1 cut(s) 165
BstNI CCWGG 1 cut(s) 24
BstSCI CCNGG 1 cut(s) 22
CciI TCATGA 1 cut(s) 99
CfoI GCGC 1 cut(s) 164
CviAII CATG 2 cut(s) 100, 202
CviJI RGCY 6 cut(s) 53, 88, 115, 122, 127, 151
CviKI_1 RGCY 6 cut(s) 53, 88, 115, 122, 127, 151
Eco57I CTGAAG 1 cut(s) 74
EcoRII CCWGG 1 cut(s) 22
Esp3I CGTCTC 1 cut(s) 165
FaeI CATG 2 cut(s) 103, 205
FaiI YATR 7 cut(s) 56, 101, 119, 135, 195, 203, 239
FatI CATG 2 cut(s) 99, 201
GlaI GCGC 1 cut(s) 163
HhaI GCGC 1 cut(s) 164
Hin1II CATG 2 cut(s) 103, 205
Hin6I GCGC 1 cut(s) 162
HinP1I GCGC 1 cut(s) 162
HindIII AAGCTT 1 cut(s) 113
HinfI GANTC 1 cut(s) 208
Hpy188I TCNGA 1 cut(s) 257
Hpy188III TCNNGA 3 cut(s) 44, 92, 100
Hsp92II CATG 2 cut(s) 103, 205
HspAI GCGC 1 cut(s) 162
LmnI GCTCC 1 cut(s) 132
LpnPI CCDG 4 cut(s) 9, 36, 63, 77
MboII GAAGA 1 cut(s) 5
MluCI AATT 1 cut(s) 7
MmeI TCCRAC 1 cut(s) 154
MspR9I CCNGG 1 cut(s) 24
MvaI CCWGG 1 cut(s) 24
NlaIII CATG 2 cut(s) 103, 205
NmeAIII GCCGAG 1 cut(s) 224
PagI TCATGA 1 cut(s) 99
PfeI GAWTC 1 cut(s) 208
Psp6I CCWGG 1 cut(s) 22
PspGI CCWGG 1 cut(s) 22
ScrFI CCNGG 1 cut(s) 24
SetI ASST 3 cut(s) 65, 117, 129
Sse9I AATT 1 cut(s) 7
SsiI CCGC 1 cut(s) 17
StyD4I CCNGG 1 cut(s) 22
TaqI TCGA 1 cut(s) 206
TasI AATT 1 cut(s) 7
TfiI GAWTC 1 cut(s) 208
TspDTI ATGAA 3 cut(s) 88, 116, 190
XapI RAATTY 1 cut(s) 7
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.