pycom10g04280

WD repeat and HMG-box DNA-binding protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Forward (+)
4507169 .. 4507399
231 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g04280.1

Sequence Viewer

Length: 231 bp
ATGCTGTGGGACCAGCAAGCTTACCACGTCGTGACAACCTTCTCCTCCGAACACACAATCACCATCCACAACTCTCTTATCCTGTCCAGCCCTCAAAAGCTCCTCTGCCACCATCGCAACAGCATCACGGCTATCGCTCTGAACCCCAACTCCACCTGCCTTGCCTTCAACTTTGTCGACCACTCCGTCAAGCTCTATAAGTTTCCCGGTCAATATCTCCCAACCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.67

Weight (kDa)

8.72

Isoelectric Point (pI)

44.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029375)

Species Orthologous Gene IDs
pyrus_communis pycom10g04280 pycom11g21260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 164
AasI GACNNNNNNGTC 1 cut(s) 185
Acc36I ACCTGC 1 cut(s) 164
AccI GTMKAC 1 cut(s) 177
AdeI CACNNNGTG 1 cut(s) 31
AgsI TTSAA 1 cut(s) 169
AjiI CACGTC 1 cut(s) 28
AloI GAACNNNNNNTCC 2 cut(s) 134, 166
AluBI AGCT 3 cut(s) 20, 100, 193
AluI AGCT 3 cut(s) 20, 100, 193
AspS9I GGNCC 1 cut(s) 10
AsuC2I CCSGG 1 cut(s) 207
AsuHPI GGTGA 1 cut(s) 52
AvaII GGWCC 1 cut(s) 10
BccI CCATC 2 cut(s) 71, 120
BceAI ACGGC 1 cut(s) 144
BcnI CCSGG 1 cut(s) 207
BfuAI ACCTGC 1 cut(s) 164
Bme1390I CCNGG 1 cut(s) 207
Bme18I GGWCC 1 cut(s) 10
BmgBI CACGTC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 10
BmiI GGNNCC 1 cut(s) 11
BmrFI CCNGG 1 cut(s) 207
BmsI GCATC 1 cut(s) 132
BpuMI CCSGG 1 cut(s) 207
BsaXI ACNNNNNCTCC 2 cut(s) 134, 164
BseGI GGATG 1 cut(s) 63
BseRI GAGGAG 2 cut(s) 34, 92
BsiSI CCGG 1 cut(s) 207
BslFI GGGAC 1 cut(s) 23
BsmFI GGGAC 1 cut(s) 23
BspLI GGNNCC 1 cut(s) 11
BspMI ACCTGC 1 cut(s) 164
BstC8I GCNNGC 1 cut(s) 18
BstF5I GGATG 1 cut(s) 63
BstMWI GCNNNNNNNGC 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 205
BtgZI GCGATG 1 cut(s) 98
BtrI CACGTC 1 cut(s) 28
BtsCI GGATG 1 cut(s) 63
BveI ACCTGC 1 cut(s) 164
Cac8I GCNNGC 1 cut(s) 18
Cfr13I GGNCC 1 cut(s) 10
CspCI CAANNNNNGTGG 2 cut(s) 142, 177
CviJI RGCY 5 cut(s) 20, 90, 100, 131, 193
CviKI_1 RGCY 5 cut(s) 20, 90, 100, 131, 193
DraIII CACNNNGTG 1 cut(s) 31
DrdI GACNNNNNNGTC 1 cut(s) 185
DseDI GACNNNNNNGTC 1 cut(s) 185
Eco47I GGWCC 1 cut(s) 10
FaiI YATR 1 cut(s) 198
FaqI GGGAC 1 cut(s) 23
FblI GTMKAC 1 cut(s) 177
FokI GGATG 1 cut(s) 50
HapII CCGG 1 cut(s) 207
HincII GTYRAC 1 cut(s) 178
HindII GTYRAC 1 cut(s) 178
HindIII AAGCTT 1 cut(s) 18
HpaII CCGG 1 cut(s) 207
HphI GGTGA 1 cut(s) 52
Hpy166II GTNNAC 1 cut(s) 178
Hpy188I TCNGA 2 cut(s) 49, 141
Hpy188III TCNNGA 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 178
Hpy99I CGWCG 1 cut(s) 32
HpyAV CCTTC 2 cut(s) 49, 175
HpyCH4IV ACGT 1 cut(s) 27
HpyF10VI GCNNNNNNNGC 1 cut(s) 114
HpySE526I ACGT 1 cut(s) 27
LmnI GCTCC 1 cut(s) 105
LpnPI CCDG 5 cut(s) 26, 95, 100, 169, 220
LweI GCATC 1 cut(s) 132
MaeII ACGT 1 cut(s) 27
MaeIII GTNAC 1 cut(s) 31
MnlI CCTC 3 cut(s) 55, 102, 113
MspI CCGG 1 cut(s) 207
MspR9I CCNGG 1 cut(s) 207
MwoI GCNNNNNNNGC 1 cut(s) 114
NciI CCSGG 1 cut(s) 207
NlaIV GGNNCC 1 cut(s) 11
NmuCI GTSAC 1 cut(s) 31
PaqCI CACCTGC 1 cut(s) 164
PcsI WCGNNNNNNNCGW 1 cut(s) 183
PspN4I GGNNCC 1 cut(s) 11
PspPI GGNCC 1 cut(s) 10
SalI GTCGAC 1 cut(s) 176
Sau96I GGNCC 1 cut(s) 10
ScrFI CCNGG 1 cut(s) 207
SetI ASST 6 cut(s) 22, 30, 41, 102, 158, 195
SfaNI GCATC 1 cut(s) 132
SinI GGWCC 1 cut(s) 10
StyD4I CCNGG 1 cut(s) 205
TaiI ACGT 1 cut(s) 30
TaqI TCGA 1 cut(s) 177
TseFI GTSAC 1 cut(s) 31
Tsp45I GTSAC 1 cut(s) 31
TspGWI ACGGA 1 cut(s) 175
VpaK11BI GGWCC 1 cut(s) 10
XmiI GTMKAC 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.