pycom12g00340

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
372846 .. 373106
261 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 261 bp
ATGGTGTTGAACAGCCATGTGGTGGTTCGGGTAGCAAATATATCAGCAAATCTATGTCAATACATCGCCTGCAATCCTGAGCGATTGAGTAGCCACCAAGTGCTCCATCTCCTCTTCTGCTTCCCTCTACACCACCTACGACGTCGTCTTGTTGCCTTTCTCTGCCTCCCTTTTCTCTCCTCCTCCGATGAAGACGACGACGACGACAACGACGACGATTCTGATCTCTCGGCCTACAGCACCAGTTCGCACTCCGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.7

Weight (kDa)

4.85

Isoelectric Point (pI)

57.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020864)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G55365
fragaria_vesca FvH4_4g27600
prunus_persica Prupe.7G004500_v2.0.a1
pyrus_communis pycom12g00340
rosa_rugosa Rorug03G0289200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 145
AccB7I CCANNNNNTGG 1 cut(s) 22
AcyI GRCGYC 1 cut(s) 142
AdeI CACNNNGTG 1 cut(s) 100
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 1 cut(s) 10
Alw21I GWGCWC 1 cut(s) 105
AoxI GGCC 1 cut(s) 231
BbsI GAAGAC 1 cut(s) 198
Bbv12I GWGCWC 1 cut(s) 105
BccI CCATC 1 cut(s) 114
BfmI CTRYAG 1 cut(s) 235
BpiI GAAGAC 1 cut(s) 198
Bpu10I CCTNAGC 1 cut(s) 78
BsaBI GATNNNNATC 1 cut(s) 222
BsaHI GRCGYC 1 cut(s) 142
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse1I ACTGG 1 cut(s) 243
Bse8I GATNNNNATC 1 cut(s) 222
BseJI GATNNNNATC 1 cut(s) 222
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 69
BseNI ACTGG 1 cut(s) 243
BseRI GAGGAG 3 cut(s) 101, 169, 172
BshFI GGCC 1 cut(s) 233
BsiHKAI GWGCWC 1 cut(s) 105
BslI CCNNNNNNNGG 1 cut(s) 22
BsnI GGCC 1 cut(s) 233
Bsp1286I GDGCHC 1 cut(s) 105
Bsp143I GATC 1 cut(s) 223
BspANI GGCC 1 cut(s) 233
BspCNI CTCAG 1 cut(s) 70
BsrI ACTGG 1 cut(s) 243
BssMI GATC 1 cut(s) 223
BssNI GRCGYC 1 cut(s) 142
Bst6I CTCTTC 1 cut(s) 119
BstACI GRCGYC 1 cut(s) 142
BstC8I GCNNGC 1 cut(s) 70
BstDEI CTNAG 1 cut(s) 78
BstKTI GATC 1 cut(s) 226
BstMBI GATC 1 cut(s) 223
BstSFI CTRYAG 1 cut(s) 235
BstV2I GAAGAC 1 cut(s) 198
BsuRI GGCC 1 cut(s) 233
BtgZI GCGATG 1 cut(s) 49
Cac8I GCNNGC 1 cut(s) 70
CviAII CATG 1 cut(s) 17
CviJI RGCY 3 cut(s) 15, 93, 233
CviKI_1 RGCY 3 cut(s) 15, 93, 233
DdeI CTNAG 1 cut(s) 78
DpnI GATC 1 cut(s) 225
DpnII GATC 1 cut(s) 223
DraIII CACNNNGTG 1 cut(s) 100
Eam1104I CTCTTC 1 cut(s) 119
EarI CTCTTC 1 cut(s) 119
FaeI CATG 1 cut(s) 20
FaiI YATR 3 cut(s) 18, 41, 55
FatI CATG 1 cut(s) 16
HaeIII GGCC 1 cut(s) 233
Hin1I GRCGYC 1 cut(s) 142
Hin1II CATG 1 cut(s) 20
HinfI GANTC 1 cut(s) 218
Hpy188I TCNGA 3 cut(s) 187, 223, 256
Hpy188III TCNNGA 1 cut(s) 77
Hpy99I CGWCG 7 cut(s) 144, 147, 200, 203, 206, 215, 218
HpyCH4IV ACGT 1 cut(s) 142
HpyCH4V TGCA 1 cut(s) 72
HpyF3I CTNAG 1 cut(s) 78
HpySE526I ACGT 1 cut(s) 142
Hsp92I GRCGYC 1 cut(s) 142
Hsp92II CATG 1 cut(s) 20
Kzo9I GATC 1 cut(s) 223
LmnI GCTCC 1 cut(s) 108
LpnPI CCDG 3 cut(s) 82, 90, 256
MaeII ACGT 1 cut(s) 142
MalI GATC 1 cut(s) 225
MboI GATC 1 cut(s) 223
MboII GAAGA 2 cut(s) 106, 203
MhlI GDGCHC 1 cut(s) 105
MnlI CCTC 5 cut(s) 122, 135, 176, 190, 193
MseI TTAA 1 cut(s) 259
NdeII GATC 1 cut(s) 223
NlaIII CATG 1 cut(s) 20
NmeAIII GCCGAG 1 cut(s) 209
PcsI WCGNNNNNNNCGW 3 cut(s) 201, 207, 210
PfeI GAWTC 1 cut(s) 218
PflFI GACNNNGTC 1 cut(s) 144
PflMI CCANNNNNTGG 1 cut(s) 22
PsyI GACNNNGTC 1 cut(s) 144
SaqAI TTAA 1 cut(s) 259
Sau3AI GATC 1 cut(s) 223
SduI GDGCHC 1 cut(s) 105
SetI ASST 2 cut(s) 138, 145
SfcI CTRYAG 1 cut(s) 235
SgeI CNNG 8 cut(s) 29, 41, 81, 89, 110, 161, 241, 255
TaiI ACGT 1 cut(s) 145
TfiI GAWTC 1 cut(s) 218
Tru1I TTAA 1 cut(s) 259
Tru9I TTAA 1 cut(s) 259
TspDTI ATGAA 1 cut(s) 204
Tth111I GACNNNGTC 1 cut(s) 144
Van91I CCANNNNNTGG 1 cut(s) 22
ZraI GACGTC 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.