pycom12g11030

Catalyzes xyloglucan endohydrolysis (XEH) and or endotransglycosylation (XET). Cleaves and religates xyloglucan polymers, an essential constituent of the primary cell wall, and thereby participates in cell wall construction of growing tissues

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0027315
Physical Location & Seq
Reverse (-)
13101035 .. 13102123
1089 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 663 bp
ATGCTCTCTCATCATCTATCCACACCTGGTTTTCCTCAGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTACTGCATTTGTACAGAGGCCAATTATTCTATTTTCTGTATACATTTCTCCTCCTCTCCCCCCATCCATGGCTATCTTCCTGTTCCTCCTGATTCTTTTAGTCCCTGCAACCAATGCTGACTGGCCACCATCACCTGGCTACTGGCCAAGCTCTAAGTTCAGGTCTATGAGCTTTTATAAAGGATTCAAAACTCTCTGGGGTCCTCAGCATCAAAGCTTAGACCAAAATGCATTAACAGTCTGGCTTGATAGCACCACAGGAAGTGGGTTCAAATCAGTTCGTCCATTTAGATCCGGTTACTTTGGTGCCTCCATTAAGCTTCAAACTGGTTACACAGCAGGAGTCATAACAGCTTTCTATCTTTCAAACAGTGAAGCTCATCCAGGATACCATGATGAAGTGGACATTGAGTTTCTTGGGACAACATTTCGGAAGCCTTATACTTTGCAGACCAATGTTTACATCAGAGGAAGTGGGGATGGAAGAATTATTGGCAGGGAGATGAAGTTTCACTTGTGGTTTGATCCCACTAAGAATTTCCATCACTATGCTATATTATGGAGTCCCAAGGACATAATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0008150 GO:0008152 GO:0009056 GO:0009987 GO:0016998 GO:0043170 GO:0044036 GO:0044237 GO:0044248 GO:0044260 GO:0071554 GO:0071704
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_hydro_16 XET_C

Protein Analysis

221

Amino Acids

24.78

Weight (kDa)

9.42

Isoelectric Point (pI)

46.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_16 PF00722 86 - 219 8.8e-36 Glycosyl hydrolases family 16
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0027315)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G36870
pyrus_communis pycom12g11030

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 258
AccB1I GGYRCC 1 cut(s) 386
AccB7I CCANNNNNTGG 1 cut(s) 215
AccI GTMKAC 1 cut(s) 120
AclWI GGATC 2 cut(s) 366, 599
AcoI YGGCCR 2 cut(s) 203, 224
AcsI RAATTY 1 cut(s) 616
AfaI GTAC 1 cut(s) 93
AfiI CCNNNNNNNGG 2 cut(s) 148, 215
AgsI TTSAA 4 cut(s) 268, 352, 404, 447
AjnI CCWGG 3 cut(s) 25, 214, 463
AluBI AGCT 7 cut(s) 40, 231, 252, 297, 400, 434, 458
AluI AGCT 7 cut(s) 40, 231, 252, 297, 400, 434, 458
AlwI GGATC 2 cut(s) 366, 599
AoxI GGCC 3 cut(s) 98, 203, 224
ApoI RAATTY 1 cut(s) 616
AspS9I GGNCC 1 cut(s) 281
AsuHPI GGTGA 1 cut(s) 204
AvaII GGWCC 1 cut(s) 281
BalI TGGCCA 2 cut(s) 205, 226
BanI GGYRCC 1 cut(s) 386
BbvCI CCTCAGC 2 cut(s) 36, 285
BccI CCATC 4 cut(s) 151, 217, 554, 630
BciT130I CCWGG 3 cut(s) 27, 216, 465
BciVI GTATCC 1 cut(s) 461
BfuI GTATCC 1 cut(s) 461
Bme1390I CCNGG 3 cut(s) 27, 216, 465
Bme18I GGWCC 1 cut(s) 281
BmgT120I GGNCC 1 cut(s) 281
BmiI GGNNCC 2 cut(s) 282, 388
BmrFI CCNGG 3 cut(s) 27, 216, 465
BmsI GCATC 1 cut(s) 298
Bpu10I CCTNAGC 2 cut(s) 36, 285
BsaJI CCNNGG 2 cut(s) 147, 648
BsaWI WCCGGW 1 cut(s) 374
BsaXI ACNNNNNCTCC 2 cut(s) 572, 602
Bsc4I CCNNNNNNNGG 2 cut(s) 148, 215
Bse1I ACTGG 3 cut(s) 206, 227, 412
BseBI CCWGG 3 cut(s) 27, 216, 465
BseDI CCNNGG 2 cut(s) 147, 648
BseGI GGATG 3 cut(s) 143, 460, 565
BseLI CCNNNNNNNGG 2 cut(s) 148, 215
BseMII CTCAG 2 cut(s) 50, 299
BseNI ACTGG 3 cut(s) 206, 227, 412
BseRI GAGGAG 2 cut(s) 120, 123
BshFI GGCC 3 cut(s) 100, 205, 226
BshNI GGYRCC 1 cut(s) 386
BsiSI CCGG 1 cut(s) 375
BslFI GGGAC 3 cut(s) 167, 514, 630
BslI CCNNNNNNNGG 2 cut(s) 148, 215
BsmFI GGGAC 3 cut(s) 167, 514, 630
BsnI GGCC 3 cut(s) 100, 205, 226
Bsp1407I TGTACA 1 cut(s) 91
Bsp143I GATC 2 cut(s) 371, 604
Bsp19I CCATGG 1 cut(s) 147
BspANI GGCC 3 cut(s) 100, 205, 226
BspCNI CTCAG 2 cut(s) 49, 298
BspLI GGNNCC 2 cut(s) 282, 388
BspPI GGATC 2 cut(s) 366, 599
BspT107I GGYRCC 1 cut(s) 386
BsrGI TGTACA 1 cut(s) 91
BsrI ACTGG 3 cut(s) 206, 227, 412
BssECI CCNNGG 2 cut(s) 147, 648
BssMI GATC 2 cut(s) 371, 604
BssNAI GTATAC 1 cut(s) 121
BssT1I CCWWGG 2 cut(s) 147, 648
Bst1107I GTATAC 1 cut(s) 121
Bst2UI CCWGG 3 cut(s) 27, 216, 465
Bst4CI ACNGT 2 cut(s) 319, 452
BstAPI GCANNNNNTGC 1 cut(s) 194
BstAUI TGTACA 1 cut(s) 91
BstDEI CTNAG 5 cut(s) 36, 234, 285, 298, 612
BstDSI CCRYGG 1 cut(s) 147
BstF5I GGATG 3 cut(s) 143, 460, 565
BstKTI GATC 2 cut(s) 374, 607
BstMBI GATC 2 cut(s) 371, 604
BstMWI GCNNNNNNNGC 1 cut(s) 194
BstNI CCWGG 3 cut(s) 27, 216, 465
BstSCI CCNGG 3 cut(s) 25, 214, 463
BstX2I RGATCY 1 cut(s) 371
BstYI RGATCY 1 cut(s) 371
BstZ17I GTATAC 1 cut(s) 121
BsuI GTATCC 1 cut(s) 461
BsuRI GGCC 3 cut(s) 100, 205, 226
BtgI CCRYGG 1 cut(s) 147
BtsCI GGATG 3 cut(s) 143, 460, 565
BtsIMutI CAGTG 1 cut(s) 457
Cfr13I GGNCC 1 cut(s) 281
CsiI ACCWGGT 1 cut(s) 25
Csp6I GTAC 1 cut(s) 92
CviAII CATG 2 cut(s) 148, 473
CviQI GTAC 1 cut(s) 92
DdeI CTNAG 5 cut(s) 36, 234, 285, 298, 612
DpnI GATC 2 cut(s) 373, 606
DpnII GATC 2 cut(s) 371, 604
EaeI YGGCCR 2 cut(s) 203, 224
Eco130I CCWWGG 2 cut(s) 147, 648
Eco47I GGWCC 1 cut(s) 281
EcoO109I RGGNCCY 1 cut(s) 281
EcoRII CCWGG 3 cut(s) 25, 214, 463
EcoT14I CCWWGG 2 cut(s) 147, 648
EcoT22I ATGCAT 1 cut(s) 313
ErhI CCWWGG 2 cut(s) 147, 648
FaeI CATG 2 cut(s) 151, 476
FalI AAGNNNNNCTT 2 cut(s) 578, 610
FaqI GGGAC 3 cut(s) 167, 514, 630
FatI CATG 2 cut(s) 147, 472
FblI GTMKAC 1 cut(s) 120
FokI GGATG 3 cut(s) 130, 447, 572
HaeIII GGCC 3 cut(s) 100, 205, 226
HapII CCGG 1 cut(s) 375
Hin1II CATG 2 cut(s) 151, 476
HindIII AAGCTT 2 cut(s) 295, 398
HinfI GANTC 4 cut(s) 172, 264, 423, 643
HpaII CCGG 1 cut(s) 375
HphI GGTGA 1 cut(s) 204
Hpy166II GTNNAC 3 cut(s) 121, 484, 541
Hpy188I TCNGA 2 cut(s) 513, 548
Hpy188III TCNNGA 1 cut(s) 169
Hpy8I GTNNAC 3 cut(s) 121, 484, 541
HpyCH4III ACNGT 2 cut(s) 319, 452
HpyCH4V TGCA 4 cut(s) 86, 188, 311, 529
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 5 cut(s) 36, 234, 285, 298, 612
Hsp92II CATG 2 cut(s) 151, 476
Kzo9I GATC 2 cut(s) 371, 604
LweI GCATC 1 cut(s) 298
MabI ACCWGGT 1 cut(s) 25
MaeIII GTNAC 2 cut(s) 377, 410
MalI GATC 2 cut(s) 373, 606
MboI GATC 2 cut(s) 371, 604
MboII GAAGA 2 cut(s) 148, 576
MflI RGATCY 1 cut(s) 371
MlsI TGGCCA 2 cut(s) 205, 226
MluCI AATT 3 cut(s) 102, 567, 616
MluNI TGGCCA 2 cut(s) 205, 226
MlyI GAGTC 2 cut(s) 432, 652
MnlI CCTC 8 cut(s) 45, 90, 141, 144, 176, 294, 400, 542
Mox20I TGGCCA 2 cut(s) 205, 226
Mph1103I ATGCAT 1 cut(s) 313
MscI TGGCCA 2 cut(s) 205, 226
MseI TTAA 2 cut(s) 314, 396
MslI CAYNNNNRTG 1 cut(s) 627
Msp20I TGGCCA 2 cut(s) 205, 226
MspI CCGG 1 cut(s) 375
MspR9I CCNGG 3 cut(s) 27, 216, 465
MvaI CCWGG 3 cut(s) 27, 216, 465
MwoI GCNNNNNNNGC 1 cut(s) 194
NcoI CCATGG 1 cut(s) 147
NdeII GATC 2 cut(s) 371, 604
NlaIII CATG 2 cut(s) 151, 476
NlaIV GGNNCC 2 cut(s) 282, 388
NsiI ATGCAT 1 cut(s) 313
PfeI GAWTC 2 cut(s) 172, 264
PflMI CCANNNNNTGG 1 cut(s) 215
PfoI TCCNGGA 1 cut(s) 463
PleI GAGTC 2 cut(s) 431, 651
PpsI GAGTC 2 cut(s) 431, 651
PpuMI RGGWCCY 1 cut(s) 281
PsiI TTATAA 1 cut(s) 258
Psp5II RGGWCCY 1 cut(s) 281
Psp6I CCWGG 3 cut(s) 25, 214, 463
PspGI CCWGG 3 cut(s) 25, 214, 463
PspN4I GGNNCC 2 cut(s) 282, 388
PspPI GGNCC 1 cut(s) 281
PspPPI RGGWCCY 1 cut(s) 281
PsuI RGATCY 1 cut(s) 371
RsaI GTAC 1 cut(s) 93
RsaNI GTAC 1 cut(s) 92
RseI CAYNNNNRTG 1 cut(s) 627
SaqAI TTAA 2 cut(s) 314, 396
Sau3AI GATC 2 cut(s) 371, 604
Sau96I GGNCC 1 cut(s) 281
SchI GAGTC 2 cut(s) 432, 652
ScrFI CCNGG 3 cut(s) 27, 216, 465
SexAI ACCWGGT 1 cut(s) 25
SfaNI GCATC 1 cut(s) 298
SinI GGWCC 1 cut(s) 281
SmiMI CAYNNNNRTG 1 cut(s) 627
Sse9I AATT 3 cut(s) 102, 567, 616
StyD4I CCNGG 3 cut(s) 25, 214, 463
StyI CCWWGG 2 cut(s) 147, 648
TaaI ACNGT 2 cut(s) 319, 452
TasI AATT 3 cut(s) 102, 567, 616
TatI WGTACW 1 cut(s) 91
TfiI GAWTC 2 cut(s) 172, 264
Tru1I TTAA 2 cut(s) 314, 396
Tru9I TTAA 2 cut(s) 314, 396
TscAI CASTG 1 cut(s) 457
TspDTI ATGAA 2 cut(s) 492, 599
TspRI CASTG 1 cut(s) 457
Van91I CCANNNNNTGG 1 cut(s) 215
VpaK11BI GGWCC 1 cut(s) 281
XapI RAATTY 1 cut(s) 616
XmiI GTMKAC 1 cut(s) 120
Zsp2I ATGCAT 1 cut(s) 313
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.