pycom12g14150

Cell differentiation protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
16709717 .. 16709911
195 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g14150.1

Sequence Viewer

Length: 195 bp
ATGGCGTCGGCGGAGCAGTTGGTACTCGAACTCAGCAACCCCCAACTTCGTGAAAACGCGCTCACTGAACTCTCCAAGAAGAGAGAATTATTTCAAGACTTGGCAACAATCACGATCCCAACAATCGGACAAAAAACAACTCAAGAACAATTGCTGAAGCACCGAAAATCTAATAGAAATTTGAAGAGAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.39

Weight (kDa)

9.99

Isoelectric Point (pI)

42.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022541)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 59
AciI CCGC 1 cut(s) 11
AclWI GGATC 1 cut(s) 109
AcsI RAATTY 1 cut(s) 178
AcuI CTGAAG 1 cut(s) 176
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 1 cut(s) 24
AfiI CCNNNNNNNGG 1 cut(s) 125
AgsI TTSAA 2 cut(s) 95, 184
AlwI GGATC 1 cut(s) 109
ApoI RAATTY 1 cut(s) 178
Asp700I GAANNNNTTC 1 cut(s) 90
AspLEI GCGC 1 cut(s) 61
BpuEI CTTGAG 1 cut(s) 126
BsaHI GRCGYC 1 cut(s) 5
Bsc4I CCNNNNNNNGG 1 cut(s) 125
BseLI CCNNNNNNNGG 1 cut(s) 125
BseMII CTCAG 1 cut(s) 46
Bsh1236I CGCG 1 cut(s) 59
BslI CCNNNNNNNGG 1 cut(s) 125
Bsp143I GATC 1 cut(s) 114
BspACI CCGC 1 cut(s) 11
BspCNI CTCAG 1 cut(s) 45
BspFNI CGCG 1 cut(s) 59
BspPI GGATC 1 cut(s) 109
BssMI GATC 1 cut(s) 114
BssNI GRCGYC 1 cut(s) 5
Bst6I CTCTTC 2 cut(s) 74, 179
BstACI GRCGYC 1 cut(s) 5
BstDEI CTNAG 1 cut(s) 32
BstFNI CGCG 1 cut(s) 59
BstHHI GCGC 1 cut(s) 61
BstKTI GATC 1 cut(s) 117
BstMBI GATC 1 cut(s) 114
BstUI CGCG 1 cut(s) 59
BtsIMutI CAGTG 1 cut(s) 63
CfoI GCGC 1 cut(s) 61
Csp6I GTAC 1 cut(s) 23
CviQI GTAC 1 cut(s) 23
DdeI CTNAG 1 cut(s) 32
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
Eam1104I CTCTTC 2 cut(s) 74, 179
EarI CTCTTC 2 cut(s) 74, 179
EciI GGCGGA 1 cut(s) 26
Eco57I CTGAAG 1 cut(s) 176
GlaI GCGC 1 cut(s) 60
HhaI GCGC 1 cut(s) 61
Hin1I GRCGYC 1 cut(s) 5
Hin6I GCGC 1 cut(s) 59
HinP1I GCGC 1 cut(s) 59
Hpy188I TCNGA 1 cut(s) 128
Hpy188III TCNNGA 4 cut(s) 50, 95, 112, 143
Hpy99I CGWCG 1 cut(s) 10
HpyF3I CTNAG 1 cut(s) 32
Hsp92I GRCGYC 1 cut(s) 5
HspAI GCGC 1 cut(s) 59
Kzo9I GATC 1 cut(s) 114
LmnI GCTCC 1 cut(s) 13
MalI GATC 1 cut(s) 116
MboI GATC 1 cut(s) 114
MboII GAAGA 1 cut(s) 91
MfeI CAATTG 1 cut(s) 149
MluCI AATT 3 cut(s) 86, 149, 178
MroXI GAANNNNTTC 1 cut(s) 90
MunI CAATTG 1 cut(s) 149
MvnI CGCG 1 cut(s) 59
NdeII GATC 1 cut(s) 114
PdmI GAANNNNTTC 1 cut(s) 90
RsaI GTAC 1 cut(s) 24
RsaNI GTAC 1 cut(s) 23
Sau3AI GATC 1 cut(s) 114
SgeI CNNG 8 cut(s) 38, 62, 70, 88, 107, 112, 124, 155
SmlI CTYRAG 1 cut(s) 141
SmoI CTYRAG 1 cut(s) 141
Sse9I AATT 3 cut(s) 86, 149, 178
SsiI CCGC 1 cut(s) 11
TaqI TCGA 1 cut(s) 27
TasI AATT 3 cut(s) 86, 149, 178
TscAI CASTG 1 cut(s) 70
TspRI CASTG 1 cut(s) 70
XapI RAATTY 1 cut(s) 178
XmnI GAANNNNTTC 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.