pycom15g16130

Autophagy-related protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
11276016 .. 11276351
336 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g16130.1

Sequence Viewer

Length: 336 bp
ATGCGTAATTGGGCATGGTTGACAGTTTCAAGCAGGTGTTTGATGAAATACCTGAGAGAAACAGGCTTTGTTGGAACTTGGAACGTTACGATTTCGAGGTATGTTAGGTGCAGGAGGTTTGAGGAGGCTTTGGATATGTTTCGGAGGATGTCATGTGAGAGCAACGATAAGCCTGATGAAGCTACGGTTGTGACCACCATTTCAGCTTGCACAACATCGAAAACTTTGGAGCTTGGTAAAGAAATTCATGAATATGTTAGAAGTGAACTTGGATTCACTACTAGAACTGGAAATGTGGTTGTTGAATATGTATGTAAAACGTGGTTATTTGATTGA

Protein Analysis

112

Amino Acids

13.01

Weight (kDa)

8.32

Isoelectric Point (pI)

46.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 25 - 70 3.2e-07 PPR repeat family
PPR PF01535 26 - 51 7.9e-06 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028359)

Species Orthologous Gene IDs
malus_domestica MD15G1179100.v1.1
pyrus_communis pycom15g16130

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 24
Acc36I ACCTGC 1 cut(s) 24
AclI AACGTT 1 cut(s) 84
AcsI RAATTY 1 cut(s) 243
AgsI TTSAA 2 cut(s) 30, 305
AluBI AGCT 3 cut(s) 182, 206, 232
AluI AGCT 3 cut(s) 182, 206, 232
ApoI RAATTY 1 cut(s) 243
BfaI CTAG 1 cut(s) 282
BfuAI ACCTGC 1 cut(s) 24
Bse1I ACTGG 1 cut(s) 292
BseGI GGATG 1 cut(s) 153
BseMII CTCAG 1 cut(s) 44
BseNI ACTGG 1 cut(s) 292
BseRI GAGGAG 1 cut(s) 137
BsgI GTGCAG 1 cut(s) 130
BspCNI CTCAG 1 cut(s) 45
BspHI TCATGA 1 cut(s) 247
BspMI ACCTGC 1 cut(s) 24
BsrI ACTGG 1 cut(s) 292
Bst4CI ACNGT 2 cut(s) 25, 187
BstC8I GCNNGC 1 cut(s) 208
BstDEI CTNAG 1 cut(s) 53
BstF5I GGATG 1 cut(s) 153
BtsCI GGATG 1 cut(s) 153
BveI ACCTGC 1 cut(s) 24
Cac8I GCNNGC 1 cut(s) 208
CciI TCATGA 1 cut(s) 247
CviAII CATG 3 cut(s) 15, 153, 248
CviJI RGCY 6 cut(s) 66, 128, 172, 182, 206, 232
CviKI_1 RGCY 6 cut(s) 66, 128, 172, 182, 206, 232
DdeI CTNAG 1 cut(s) 53
FaeI CATG 3 cut(s) 18, 156, 251
FaiI YATR 8 cut(s) 16, 102, 137, 154, 249, 255, 309, 313
FatI CATG 3 cut(s) 14, 152, 247
FokI GGATG 1 cut(s) 160
FspBI CTAG 1 cut(s) 282
Hin1II CATG 3 cut(s) 18, 156, 251
HincII GTYRAC 1 cut(s) 21
HindII GTYRAC 1 cut(s) 21
HinfI GANTC 1 cut(s) 273
Hpy166II GTNNAC 2 cut(s) 21, 266
Hpy188I TCNGA 1 cut(s) 144
Hpy188III TCNNGA 1 cut(s) 248
Hpy8I GTNNAC 2 cut(s) 21, 266
HpyCH4III ACNGT 2 cut(s) 25, 187
HpyCH4IV ACGT 2 cut(s) 84, 320
HpyCH4V TGCA 2 cut(s) 111, 210
HpyF3I CTNAG 1 cut(s) 53
HpySE526I ACGT 2 cut(s) 84, 320
Hsp92II CATG 3 cut(s) 18, 156, 251
LmnI GCTCC 1 cut(s) 229
LpnPI CCDG 6 cut(s) 19, 48, 65, 97, 186, 273
MaeI CTAG 1 cut(s) 282
MaeII ACGT 2 cut(s) 84, 320
MaeIII GTNAC 2 cut(s) 85, 190
MluCI AATT 2 cut(s) 7, 243
MmeI TCCRAC 1 cut(s) 52
MnlI CCTC 5 cut(s) 90, 108, 115, 118, 138
MslI CAYNNNNRTG 1 cut(s) 252
NlaIII CATG 3 cut(s) 18, 156, 251
NmuCI GTSAC 1 cut(s) 190
PagI TCATGA 1 cut(s) 247
PaqCI CACCTGC 1 cut(s) 24
PfeI GAWTC 1 cut(s) 273
Psp1406I AACGTT 1 cut(s) 84
RseI CAYNNNNRTG 1 cut(s) 252
SmiMI CAYNNNNRTG 1 cut(s) 252
Sse9I AATT 2 cut(s) 7, 243
SspMI CTAG 1 cut(s) 282
TaaI ACNGT 2 cut(s) 25, 187
TaiI ACGT 2 cut(s) 87, 323
TaqI TCGA 2 cut(s) 95, 218
TasI AATT 2 cut(s) 7, 243
TfiI GAWTC 1 cut(s) 273
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 4 cut(s) 59, 192, 236, 264
XapI RAATTY 1 cut(s) 243
XspI CTAG 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.