pycom15g34190

Belongs to the cyclin family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
33846932 .. 33847527
596 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGCTCATTCAACATGTACACTTAGTAAAGGAGAGAGTGGCAAAGTGTGTAAATATGATTCATGATATGGCATTGATGAGTGGGACCCCCATGAGGGAAGCTAGCGGGTCAGCCCAGAGCGTGGCCCAGAGTCCAATAGGGGTATTGGATGCCGGATGCTTCAGCTATAAAAGTGATGAAACCACGGTTGGGTCATGTGCAAATTCCTTCCACGATAGCTCAGATTCTAAAAGAAGGAAGCTAAACGGACCCTCTGAGGTGGAGTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

9.58

Weight (kDa)

6.39

Isoelectric Point (pI)

49.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029469)

Species Orthologous Gene IDs
pyrus_communis pycom15g34190
rosa_samantha Rh7AG461100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 121
AciI CCGC 1 cut(s) 105
AcsI RAATTY 1 cut(s) 202
AcuI CTGAAG 1 cut(s) 145
AfaI GTAC 1 cut(s) 18
AfiI CCNNNNNNNGG 4 cut(s) 93, 94, 121, 189
AflIII ACRYGT 1 cut(s) 13
AgsI TTSAA 1 cut(s) 11
AjuI GAANNNNNNNTTGG 2 cut(s) 171, 203
AluBI AGCT 4 cut(s) 101, 165, 219, 241
AluI AGCT 4 cut(s) 101, 165, 219, 241
AoxI GGCC 1 cut(s) 123
ApoI RAATTY 1 cut(s) 202
AspS9I GGNCC 3 cut(s) 84, 124, 248
AsuNHI GCTAGC 1 cut(s) 101
AvaII GGWCC 2 cut(s) 84, 248
BfaI CTAG 1 cut(s) 102
Bme18I GGWCC 2 cut(s) 84, 248
BmgT120I GGNCC 3 cut(s) 84, 124, 248
BmiI GGNNCC 3 cut(s) 85, 86, 250
BmsI GCATC 2 cut(s) 139, 146
BmtI GCTAGC 1 cut(s) 105
BsaJI CCNNGG 1 cut(s) 183
Bsc4I CCNNNNNNNGG 4 cut(s) 93, 94, 121, 189
BseDI CCNNGG 1 cut(s) 183
BseGI GGATG 2 cut(s) 154, 161
BseLI CCNNNNNNNGG 4 cut(s) 93, 94, 121, 189
BseMII CTCAG 2 cut(s) 234, 246
BshFI GGCC 1 cut(s) 125
BsiSI CCGG 1 cut(s) 153
BslFI GGGAC 1 cut(s) 97
BslI CCNNNNNNNGG 4 cut(s) 93, 94, 121, 189
BsmFI GGGAC 1 cut(s) 97
BsnI GGCC 1 cut(s) 125
Bsp1407I TGTACA 1 cut(s) 16
BspACI CCGC 1 cut(s) 105
BspANI GGCC 1 cut(s) 125
BspCNI CTCAG 2 cut(s) 233, 247
BspHI TCATGA 1 cut(s) 61
BspLI GGNNCC 3 cut(s) 85, 86, 250
BspOI GCTAGC 1 cut(s) 105
BsrGI TGTACA 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 183
Bst4CI ACNGT 1 cut(s) 187
BstAUI TGTACA 1 cut(s) 16
BstC8I GCNNGC 1 cut(s) 103
BstDEI CTNAG 3 cut(s) 22, 220, 255
BstDSI CCRYGG 1 cut(s) 183
BstF5I GGATG 2 cut(s) 154, 161
BstNSI RCATGY 1 cut(s) 17
BsuRI GGCC 1 cut(s) 125
BtgI CCRYGG 1 cut(s) 183
BtsCI GGATG 2 cut(s) 154, 161
Cac8I GCNNGC 1 cut(s) 103
CciI TCATGA 1 cut(s) 61
Cfr13I GGNCC 3 cut(s) 84, 124, 248
Csp6I GTAC 1 cut(s) 17
CviAII CATG 4 cut(s) 14, 62, 91, 195
CviJI RGCY 6 cut(s) 101, 113, 125, 165, 219, 241
CviKI_1 RGCY 6 cut(s) 101, 113, 125, 165, 219, 241
CviQI GTAC 1 cut(s) 17
DdeI CTNAG 3 cut(s) 22, 220, 255
Eco47I GGWCC 2 cut(s) 84, 248
Eco57I CTGAAG 1 cut(s) 145
EcoO109I RGGNCCY 1 cut(s) 84
FaeI CATG 4 cut(s) 17, 65, 94, 198
FaiI YATR 7 cut(s) 15, 56, 63, 68, 92, 168, 196
FaqI GGGAC 1 cut(s) 97
FatI CATG 4 cut(s) 13, 61, 90, 194
FauI CCCGC 1 cut(s) 98
FokI GGATG 2 cut(s) 161, 168
FspBI CTAG 1 cut(s) 102
HaeIII GGCC 1 cut(s) 125
HapII CCGG 1 cut(s) 153
Hin1II CATG 4 cut(s) 17, 65, 94, 198
HinfI GANTC 3 cut(s) 58, 130, 224
HpaII CCGG 1 cut(s) 153
Hpy166II GTNNAC 1 cut(s) 19
Hpy188I TCNGA 2 cut(s) 223, 256
Hpy188III TCNNGA 1 cut(s) 62
Hpy8I GTNNAC 1 cut(s) 19
HpyAV CCTTC 2 cut(s) 217, 228
HpyCH4III ACNGT 1 cut(s) 187
HpyCH4V TGCA 1 cut(s) 200
HpyF3I CTNAG 3 cut(s) 22, 220, 255
Hsp92II CATG 4 cut(s) 17, 65, 94, 198
KflI GGGWCCC 1 cut(s) 84
LpnPI CCDG 3 cut(s) 128, 140, 166
LweI GCATC 2 cut(s) 139, 146
MaeI CTAG 1 cut(s) 102
MluCI AATT 1 cut(s) 202
MlyI GAGTC 1 cut(s) 139
MnlI CCTC 3 cut(s) 87, 250, 262
MspI CCGG 1 cut(s) 153
NheI GCTAGC 1 cut(s) 101
NlaIII CATG 4 cut(s) 17, 65, 94, 198
NlaIV GGNNCC 3 cut(s) 85, 86, 250
NspI RCATGY 1 cut(s) 17
PagI TCATGA 1 cut(s) 61
PciI ACATGT 1 cut(s) 13
PfeI GAWTC 2 cut(s) 58, 224
PflMI CCANNNNNTGG 1 cut(s) 121
PleI GAGTC 1 cut(s) 138
PpsI GAGTC 1 cut(s) 138
PpuMI RGGWCCY 1 cut(s) 84
PscI ACATGT 1 cut(s) 13
Psp5II RGGWCCY 1 cut(s) 84
PspN4I GGNNCC 3 cut(s) 85, 86, 250
PspPI GGNCC 3 cut(s) 84, 124, 248
PspPPI RGGWCCY 1 cut(s) 84
RsaI GTAC 1 cut(s) 18
RsaNI GTAC 1 cut(s) 17
Sau96I GGNCC 3 cut(s) 84, 124, 248
SchI GAGTC 1 cut(s) 139
SetI ASST 5 cut(s) 103, 167, 221, 243, 261
SfaNI GCATC 2 cut(s) 139, 146
SinI GGWCC 2 cut(s) 84, 248
Sse9I AATT 1 cut(s) 202
SsiI CCGC 1 cut(s) 105
SspMI CTAG 1 cut(s) 102
TaaI ACNGT 1 cut(s) 187
TasI AATT 1 cut(s) 202
TatI WGTACW 1 cut(s) 16
TfiI GAWTC 2 cut(s) 58, 224
TspDTI ATGAA 2 cut(s) 50, 192
TspGWI ACGGA 1 cut(s) 261
Van91I CCANNNNNTGG 1 cut(s) 121
VpaK11BI GGWCC 2 cut(s) 84, 248
XapI RAATTY 1 cut(s) 202
XceI RCATGY 1 cut(s) 17
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.