pycom16g17670

BSD domain-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
13930955 .. 13931158
204 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g17670.1

Sequence Viewer

Length: 204 bp
ATGGATTTCTTCAAGTCGGTCTTCTCCAATGACCCCCTTCTCTTTGACGATCTGCATCCGGACGCCCAAAACGACGACTTTGACCCAAACTCGGATTGGGAACCGGATTGCAATCCGTGTTCGAATTACAGCACTAGGGCTTGGATCTTCGAAGGTCTGATTTGCGACAATGTCCAAGTCTGTCATCTAGAACTACTACCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.77

Weight (kDa)

4.05

Isoelectric Point (pI)

17.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029209)

Species Orthologous Gene IDs
pyrus_communis pycom02g02460 pycom16g17670

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 58
AclWI GGATC 1 cut(s) 152
AcyI GRCGYC 1 cut(s) 63
AfiI CCNNNNNNNGG 1 cut(s) 91
AgsI TTSAA 1 cut(s) 13
AlwI GGATC 1 cut(s) 152
Aor13HI TCCGGA 1 cut(s) 58
AsuII TTCGAA 2 cut(s) 122, 150
BbsI GAAGAC 1 cut(s) 13
BfaI CTAG 2 cut(s) 135, 188
BmiI GGNNCC 1 cut(s) 102
BmsI GCATC 1 cut(s) 64
BpiI GAAGAC 1 cut(s) 13
Bpu14I TTCGAA 2 cut(s) 122, 150
BsaBI GATNNNNATC 2 cut(s) 54, 111
BsaHI GRCGYC 1 cut(s) 63
BsaWI WCCGGW 2 cut(s) 58, 103
Bsc4I CCNNNNNNNGG 1 cut(s) 91
Bse8I GATNNNNATC 2 cut(s) 54, 111
BseAI TCCGGA 1 cut(s) 58
BseGI GGATG 1 cut(s) 55
BseJI GATNNNNATC 2 cut(s) 54, 111
BseLI CCNNNNNNNGG 1 cut(s) 91
BsiSI CCGG 2 cut(s) 59, 104
BslI CCNNNNNNNGG 1 cut(s) 91
Bsp119I TTCGAA 2 cut(s) 122, 150
Bsp13I TCCGGA 1 cut(s) 58
Bsp143I GATC 2 cut(s) 49, 144
BspEI TCCGGA 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 102
BspPI GGATC 1 cut(s) 152
BspT104I TTCGAA 2 cut(s) 122, 150
BssMI GATC 2 cut(s) 49, 144
BssNI GRCGYC 1 cut(s) 63
Bst4CI ACNGT 1 cut(s) 201
BstACI GRCGYC 1 cut(s) 63
BstBI TTCGAA 2 cut(s) 122, 150
BstF5I GGATG 1 cut(s) 55
BstKTI GATC 2 cut(s) 52, 147
BstMBI GATC 2 cut(s) 49, 144
BstV2I GAAGAC 1 cut(s) 13
BstX2I RGATCY 1 cut(s) 144
BstYI RGATCY 1 cut(s) 144
BtsCI GGATG 1 cut(s) 55
CseI GACGC 1 cut(s) 71
CviJI RGCY 1 cut(s) 140
CviKI_1 RGCY 1 cut(s) 140
DpnI GATC 2 cut(s) 51, 146
DpnII GATC 2 cut(s) 49, 144
FalI AAGNNNNNCTT 1 cut(s) 37
FokI GGATG 1 cut(s) 42
FspBI CTAG 2 cut(s) 135, 188
HapII CCGG 2 cut(s) 59, 104
HgaI GACGC 1 cut(s) 71
Hin1I GRCGYC 1 cut(s) 63
HpaII CCGG 2 cut(s) 59, 104
Hpy188I TCNGA 2 cut(s) 94, 159
Hpy188III TCNNGA 2 cut(s) 59, 188
Hpy99I CGWCG 1 cut(s) 77
HpyAV CCTTC 2 cut(s) 47, 146
HpyCH4III ACNGT 1 cut(s) 201
HpyCH4V TGCA 2 cut(s) 55, 111
Hsp92I GRCGYC 1 cut(s) 63
Kpn2I TCCGGA 1 cut(s) 58
Kzo9I GATC 2 cut(s) 49, 144
LpnPI CCDG 2 cut(s) 72, 117
LweI GCATC 1 cut(s) 64
MaeI CTAG 2 cut(s) 135, 188
MalI GATC 2 cut(s) 51, 146
MboI GATC 2 cut(s) 49, 144
MboII GAAGA 2 cut(s) 13, 139
MflI RGATCY 1 cut(s) 144
MluCI AATT 1 cut(s) 124
MroI TCCGGA 1 cut(s) 58
MspI CCGG 2 cut(s) 59, 104
NdeII GATC 2 cut(s) 49, 144
NlaIV GGNNCC 1 cut(s) 102
NspV TTCGAA 2 cut(s) 122, 150
PcsI WCGNNNNNNNCGW 1 cut(s) 69
PflFI GACNNNGTC 1 cut(s) 170
PspN4I GGNNCC 1 cut(s) 102
PsuI RGATCY 1 cut(s) 144
PsyI GACNNNGTC 1 cut(s) 170
Sau3AI GATC 2 cut(s) 49, 144
SetI ASST 1 cut(s) 157
SfaNI GCATC 1 cut(s) 64
SfuI TTCGAA 2 cut(s) 122, 150
SgeI CNNG 9 cut(s) 25, 71, 103, 116, 129, 147, 153, 188, 200
Sse9I AATT 1 cut(s) 124
SspMI CTAG 2 cut(s) 135, 188
TaaI ACNGT 1 cut(s) 201
TaqI TCGA 2 cut(s) 122, 150
TaqII GACCGA 1 cut(s) 7
TasI AATT 1 cut(s) 124
TspGWI ACGGA 1 cut(s) 105
Tth111I GACNNNGTC 1 cut(s) 170
XbaI TCTAGA 1 cut(s) 187
XcmI CCANNNNNNNNNTGG 1 cut(s) 93
XspI CTAG 2 cut(s) 135, 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.