pycom16g17790

NDH shuttles electrons from NAD(P)H plastoquinone, via FMN and iron-sulfur (Fe-S) centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain. The immediate electron acceptor for the enzyme in this species is believed to be plastoquinone. Couples the redox reaction to proton translocation, and thus conserves the redox energy in a proton gradient

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
14051866 .. 14052161
296 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 204 bp
ATGCGTTCGTTCTGTATATTTCGTGGTAATTGCGTTGAGTATTGTCCAACGAATTGTTTATCAATGATTGAAGAATATGAACTTTCTACTTATGATCGTCACGAATTGAATTATAATCAAATTGCTTTGGGTCGTTTACCAATGTCAGTAATTGACTATTATACAATTCAAACAATTTTGAATTCGCCTCAAATAAATAAGTAA

Protein Analysis

68

Amino Acids

7.92

Weight (kDa)

5.09

Isoelectric Point (pI)

53.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021958)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG01090
pyrus_communis pycom16g17790
rosa_chinensis RchiOBHm_Chr5g0017191 RchiOBHm_CPg0502751

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 114
AcsI RAATTY 1 cut(s) 181
AgsI TTSAA 4 cut(s) 71, 109, 170, 181
ApoI RAATTY 1 cut(s) 181
Bsp143I GATC 1 cut(s) 94
BssMI GATC 1 cut(s) 94
BstKTI GATC 1 cut(s) 97
BstMBI GATC 1 cut(s) 94
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
EcoRI GAATTC 1 cut(s) 181
FaiI YATR 5 cut(s) 17, 78, 93, 114, 162
FspEI CC 5 cut(s) 9, 60, 113, 114, 153
Hpy166II GTNNAC 1 cut(s) 137
Hpy188III TCNNGA 1 cut(s) 101
Hpy8I GTNNAC 1 cut(s) 137
Kzo9I GATC 1 cut(s) 94
MaeIII GTNAC 1 cut(s) 98
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MboII GAAGA 1 cut(s) 83
MluCI AATT 9 cut(s) 28, 52, 104, 109, 120, 150, 165, 174, 181
MmeI TCCRAC 1 cut(s) 71
MnlI CCTC 1 cut(s) 198
NdeII GATC 1 cut(s) 94
NmuCI GTSAC 1 cut(s) 98
PsiI TTATAA 1 cut(s) 114
Sau3AI GATC 1 cut(s) 94
SgeI CNNG 2 cut(s) 35, 113
Sse9I AATT 9 cut(s) 28, 52, 104, 109, 120, 150, 165, 174, 181
TasI AATT 9 cut(s) 28, 52, 104, 109, 120, 150, 165, 174, 181
TseFI GTSAC 1 cut(s) 98
Tsp45I GTSAC 1 cut(s) 98
TspDTI ATGAA 1 cut(s) 93
XapI RAATTY 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.