pycom16g20790

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
18803325 .. 18804377
1053 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 516 bp
ATGGAGGAAGTCTTGAAAAAATATTCTGATCTCTATGACACCACTGTGCAAGTCAAGAAAGATAACTCTATCTTGAGAAAGAAACTGGCACTAGTTGAAAGTGAAAAGAAGGAAAAAGCTCTTAAGGATAAACTGGTTGAGGTAAAAGGAAAAGTTCAAGAACTAAGCATAGGTTCGGGAAAATTTGACAAGATGCTTAGCTATGCAAAAGAGTTTTGGAGACAAAAGAAGTCTAGGATTCGAGCTAGATATTGCAATTTTTTCTTCTTATTAAAAAAAAATTGTGTGAGACGAAATGAAAAACTATGTTTTTCATATGAGTTTTGTTACAACCCGTATCTTAGAATACTGTATTTTATTCTTGAACCTTGTGAAATGACTAAAATACCCCAATTGGATGTCTTGAGTAAATATCGAGCCTTGAGCTTAAATTTCAATTTCTCATATTTTCTTGGTTTCTTTAATTGTTTTCGTACTCATGAGCGTGTGAGTGAAGATCGGAGTTACGAGGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

172

Amino Acids

20.6

Weight (kDa)

9.45

Isoelectric Point (pI)

24.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028323)

Species Orthologous Gene IDs
malus_domestica MD14G1099000.v1.1
pyrus_communis pycom16g20790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 182, 430
AfaI GTAC 1 cut(s) 475
AflII CTTAAG 1 cut(s) 122
AgsI TTSAA 5 cut(s) 16, 98, 158, 365, 436
AhlI ACTAGT 1 cut(s) 91
AleI CACNNNNGTG 1 cut(s) 44
AluBI AGCT 4 cut(s) 119, 201, 245, 426
AluI AGCT 4 cut(s) 119, 201, 245, 426
Alw26I GTCTC 2 cut(s) 214, 283
ApoI RAATTY 2 cut(s) 182, 430
BcoDI GTCTC 2 cut(s) 214, 283
BcuI ACTAGT 1 cut(s) 91
BfaI CTAG 3 cut(s) 92, 234, 246
BfrI CTTAAG 1 cut(s) 122
BlpI GCTNAGC 1 cut(s) 197
BmsI GCATC 1 cut(s) 183
Bpu1102I GCTNAGC 1 cut(s) 197
BpuEI CTTGAG 3 cut(s) 94, 424, 442
Bse1I ACTGG 2 cut(s) 90, 138
BseGI GGATG 1 cut(s) 403
BseNI ACTGG 2 cut(s) 90, 138
BsmAI GTCTC 2 cut(s) 214, 283
BsmBI CGTCTC 1 cut(s) 283
Bsp143I GATC 2 cut(s) 28, 496
Bsp1720I GCTNAGC 1 cut(s) 197
BspHI TCATGA 1 cut(s) 478
BspTI CTTAAG 1 cut(s) 122
BsrI ACTGG 2 cut(s) 90, 138
BssMI GATC 2 cut(s) 28, 496
Bst4CI ACNGT 2 cut(s) 46, 351
BstAFI CTTAAG 1 cut(s) 122
BstDEI CTNAG 3 cut(s) 164, 197, 341
BstF5I GGATG 1 cut(s) 403
BstKTI GATC 2 cut(s) 31, 499
BstMAI GTCTC 2 cut(s) 214, 283
BstMBI GATC 2 cut(s) 28, 496
BtsCI GGATG 1 cut(s) 403
BtsIMutI CAGTG 1 cut(s) 42
CciI TCATGA 1 cut(s) 478
Csp6I GTAC 1 cut(s) 474
CviAII CATG 1 cut(s) 479
CviJI RGCY 5 cut(s) 119, 201, 245, 419, 426
CviKI_1 RGCY 5 cut(s) 119, 201, 245, 419, 426
CviQI GTAC 1 cut(s) 474
DdeI CTNAG 3 cut(s) 164, 197, 341
DpnI GATC 2 cut(s) 30, 498
DpnII GATC 2 cut(s) 28, 496
Esp3I CGTCTC 1 cut(s) 283
FaeI CATG 1 cut(s) 482
FaiI YATR 8 cut(s) 36, 170, 204, 307, 316, 318, 445, 480
FatI CATG 1 cut(s) 478
FauNDI CATATG 1 cut(s) 316
FokI GGATG 1 cut(s) 410
FspBI CTAG 3 cut(s) 92, 234, 246
Hin1II CATG 1 cut(s) 482
HinfI GANTC 1 cut(s) 238
Hpy188I TCNGA 2 cut(s) 28, 501
Hpy188III TCNNGA 8 cut(s) 13, 55, 73, 158, 177, 362, 403, 479
HpyAV CCTTC 1 cut(s) 103
HpyCH4III ACNGT 2 cut(s) 46, 351
HpyCH4V TGCA 3 cut(s) 49, 206, 255
HpyF3I CTNAG 3 cut(s) 164, 197, 341
Hsp92II CATG 1 cut(s) 482
Kzo9I GATC 2 cut(s) 28, 496
LpnPI CCDG 2 cut(s) 71, 119
LweI GCATC 1 cut(s) 183
MaeI CTAG 3 cut(s) 92, 234, 246
MaeIII GTNAC 2 cut(s) 326, 503
MalI GATC 2 cut(s) 30, 498
MboI GATC 2 cut(s) 28, 496
MboII GAAGA 2 cut(s) 256, 506
MfeI CAATTG 1 cut(s) 392
MluCI AATT 7 cut(s) 182, 256, 280, 392, 430, 436, 463
MnlI CCTC 2 cut(s) 133, 502
MseI TTAA 4 cut(s) 123, 272, 428, 462
MslI CAYNNNNRTG 2 cut(s) 44, 483
MspCI CTTAAG 1 cut(s) 122
MunI CAATTG 1 cut(s) 392
NdeI CATATG 1 cut(s) 316
NdeII GATC 2 cut(s) 28, 496
NlaIII CATG 1 cut(s) 482
OliI CACNNNNGTG 1 cut(s) 44
PagI TCATGA 1 cut(s) 478
PfeI GAWTC 1 cut(s) 238
RsaI GTAC 1 cut(s) 475
RsaNI GTAC 1 cut(s) 474
RseI CAYNNNNRTG 2 cut(s) 44, 483
SaqAI TTAA 4 cut(s) 123, 272, 428, 462
Sau3AI GATC 2 cut(s) 28, 496
SetI ASST 7 cut(s) 121, 144, 175, 203, 247, 370, 428
SfaNI GCATC 1 cut(s) 183
SmiMI CAYNNNNRTG 2 cut(s) 44, 483
SmlI CTYRAG 4 cut(s) 73, 122, 403, 421
SmoI CTYRAG 4 cut(s) 73, 122, 403, 421
SpeI ACTAGT 1 cut(s) 91
Sse9I AATT 7 cut(s) 182, 256, 280, 392, 430, 436, 463
SspI AATATT 1 cut(s) 23
SspMI CTAG 3 cut(s) 92, 234, 246
TaaI ACNGT 2 cut(s) 46, 351
TaqI TCGA 2 cut(s) 241, 415
TasI AATT 7 cut(s) 182, 256, 280, 392, 430, 436, 463
TfiI GAWTC 1 cut(s) 238
Tru1I TTAA 4 cut(s) 123, 272, 428, 462
Tru9I TTAA 4 cut(s) 123, 272, 428, 462
TscAI CASTG 1 cut(s) 49
TspDTI ATGAA 2 cut(s) 303, 312
TspRI CASTG 1 cut(s) 49
Vha464I CTTAAG 1 cut(s) 122
XapI RAATTY 2 cut(s) 182, 430
XspI CTAG 3 cut(s) 92, 234, 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.