Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0022039

Physical Location & Seq

Genomic Coordinates Reverse (-)

43873 .. 45209

Gene Structure 1337 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 201 bp

ATGGCCAAGGGTAAAGATGTCCGAGTAACGGTGATTTTGGAATGTACCAGTTGTGTTCGAAATCGTGTTAATAAGGAATCAACGGGCATTTCCAGATATATTACTCAAAAGAATCGACATAATACGCCTAGTCGATTGGAATTGAGAAAATTCTGTCCCTGTTGTTACAAACATACGATTCACGGGGAGATAAAGAAATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_L33

Protein Analysis

66

Amino Acids

7.68

Weight (kDa)

9.91

Isoelectric Point (pI)

48.0

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ribosomal_L33	PF00471	10 - 65	1.8e-19	Ribosomal protein L33

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022039)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATCG00640
rosa_chinensis	RchiOBHm_CPg0502021
rosa_roxburghii	Rroxscaffold_2G00119040
rosa_wichuraiana	Rw2G016980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	3
AcsI	RAATTY	1 cut(s)	149
AfaI	GTAC	1 cut(s)	46
AfiI	CCNNNNNNNGG	1 cut(s)	28
AoxI	GGCC	1 cut(s)	3
ApoI	RAATTY	1 cut(s)	149
AsuHPI	GGTGA	1 cut(s)	43
AsuII	TTCGAA	1 cut(s)	58
BalI	TGGCCA	1 cut(s)	5
BfaI	CTAG	1 cut(s)	129
Bpu14I	TTCGAA	1 cut(s)	58
BsaJI	CCNNGG	1 cut(s)	6
Bsc4I	CCNNNNNNNGG	1 cut(s)	28
Bse1I	ACTGG	1 cut(s)	48
BseDI	CCNNGG	1 cut(s)	6
BseLI	CCNNNNNNNGG	1 cut(s)	28
BseNI	ACTGG	1 cut(s)	48
BshFI	GGCC	1 cut(s)	5
BslFI	GGGAC	1 cut(s)	141
BslI	CCNNNNNNNGG	1 cut(s)	28
BsmFI	GGGAC	1 cut(s)	141
BsnI	GGCC	1 cut(s)	5
Bsp119I	TTCGAA	1 cut(s)	58
BspANI	GGCC	1 cut(s)	5
BspT104I	TTCGAA	1 cut(s)	58
BsrI	ACTGG	1 cut(s)	48
BssECI	CCNNGG	1 cut(s)	6
BssT1I	CCWWGG	1 cut(s)	6
Bst4CI	ACNGT	1 cut(s)	31
BstBI	TTCGAA	1 cut(s)	58
BsuRI	GGCC	1 cut(s)	5
Csp6I	GTAC	1 cut(s)	45
CviJI	RGCY	1 cut(s)	5
CviKI_1	RGCY	1 cut(s)	5
CviQI	GTAC	1 cut(s)	45
EaeI	YGGCCR	1 cut(s)	3
Eco130I	CCWWGG	1 cut(s)	6
EcoT14I	CCWWGG	1 cut(s)	6
ErhI	CCWWGG	1 cut(s)	6
FaiI	YATR	3 cut(s)	99, 120, 174
FaqI	GGGAC	1 cut(s)	141
FspBI	CTAG	1 cut(s)	129
HaeIII	GGCC	1 cut(s)	5
HinfI	GANTC	3 cut(s)	77, 112, 178
HphI	GGTGA	1 cut(s)	43
Hpy188I	TCNGA	1 cut(s)	23
Hpy188III	TCNNGA	1 cut(s)	93
HpyCH4III	ACNGT	1 cut(s)	31
LpnPI	CCDG	3 cut(s)	61, 106, 172
MaeI	CTAG	1 cut(s)	129
MaeIII	GTNAC	2 cut(s)	25, 164
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	2 cut(s)	140, 149
MluNI	TGGCCA	1 cut(s)	5
Mox20I	TGGCCA	1 cut(s)	5
MscI	TGGCCA	1 cut(s)	5
MseI	TTAA	1 cut(s)	69
Msp20I	TGGCCA	1 cut(s)	5
NspV	TTCGAA	1 cut(s)	58
PfeI	GAWTC	3 cut(s)	77, 112, 178
RsaI	GTAC	1 cut(s)	46
RsaNI	GTAC	1 cut(s)	45
SaqAI	TTAA	1 cut(s)	69
SfuI	TTCGAA	1 cut(s)	58
Sse9I	AATT	2 cut(s)	140, 149
SspMI	CTAG	1 cut(s)	129
StyI	CCWWGG	1 cut(s)	6
TaaI	ACNGT	1 cut(s)	31
TaqI	TCGA	3 cut(s)	58, 115, 133
TasI	AATT	2 cut(s)	140, 149
TfiI	GAWTC	3 cut(s)	77, 112, 178
Tru1I	TTAA	1 cut(s)	69
Tru9I	TTAA	1 cut(s)	69
XapI	RAATTY	1 cut(s)	149
XspI	CTAG	1 cut(s)	129

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.