RchiOBHm_Chr7g0182411

COBRA-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0030418
Physical Location & Seq
Forward (+)
3659067 .. 3659712
646 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 375 bp
ATGCTGTGTGTCTCTGTCTTCCTTCTACAACCCCTTGATCACTCCTTGTCCATCTTGTGCTTGAGGAATGACCTCATGGATTCAAGTCTGCTACAATCAAATACCTCAGCCAAGGAAAATGCACCACAACTGTTACAATGCACAGAACACAACTGCCCAATCCGAGTTCATTGGCATGTGAAAGCTAACTACAGAGAGTATTGGCGTGTGCAAATTACCATCACCAATTTTAACTTCCTCATGAATTACACACAATGGACACTAGTTGTTCAGCACCCAAATCTCAACAAACTGGCCAATATACCTAGCTTCTTTCTTAACCAGTTTTTATTGTGTTTAATTCTGCAGATGACACTGGCATGTTTTATGGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
COBRA

Protein Analysis

124

Amino Acids

14.5

Weight (kDa)

7.66

Isoelectric Point (pI)

47.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
COB_C PF25079 29 - 105 1.5e-21 COBRA family C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030418)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0182411
rosa_samantha Rh7AG050900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 294
AgsI TTSAA 1 cut(s) 84
AhlI ACTAGT 1 cut(s) 262
AjuI GAANNNNNNNTTGG 2 cut(s) 218, 250
AluBI AGCT 2 cut(s) 185, 309
AluI AGCT 2 cut(s) 185, 309
Alw26I GTCTC 1 cut(s) 16
AoxI GGCC 1 cut(s) 294
AsuHPI GGTGA 1 cut(s) 214
BalI TGGCCA 1 cut(s) 296
BbsI GAAGAC 1 cut(s) 10
BbvCI CCTCAGC 1 cut(s) 106
BccI CCATC 2 cut(s) 59, 227
BclI TGATCA 1 cut(s) 37
BcoDI GTCTC 1 cut(s) 16
BcuI ACTAGT 1 cut(s) 262
BfaI CTAG 2 cut(s) 263, 306
BfmI CTRYAG 2 cut(s) 190, 344
BpiI GAAGAC 1 cut(s) 10
Bpu10I CCTNAGC 1 cut(s) 106
BpuEI CTTGAG 1 cut(s) 82
BsaJI CCNNGG 1 cut(s) 111
Bse1I ACTGG 3 cut(s) 297, 322, 360
BseDI CCNNGG 1 cut(s) 111
BseMII CTCAG 1 cut(s) 120
BseNI ACTGG 3 cut(s) 297, 322, 360
BshFI GGCC 1 cut(s) 296
BsmAI GTCTC 1 cut(s) 16
BsnI GGCC 1 cut(s) 296
Bsp143I GATC 1 cut(s) 37
BspANI GGCC 1 cut(s) 296
BspCNI CTCAG 1 cut(s) 119
BspHI TCATGA 1 cut(s) 240
BspMAI CTGCAG 1 cut(s) 348
BsrI ACTGG 3 cut(s) 297, 322, 360
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 1 cut(s) 37
BssT1I CCWWGG 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 132
BstDEI CTNAG 1 cut(s) 106
BstKTI GATC 1 cut(s) 40
BstMAI GTCTC 1 cut(s) 16
BstMBI GATC 1 cut(s) 37
BstNSI RCATGY 2 cut(s) 179, 363
BstSFI CTRYAG 2 cut(s) 190, 344
BstV2I GAAGAC 1 cut(s) 10
BsuRI GGCC 1 cut(s) 296
BtsIMutI CAGTG 1 cut(s) 353
CciI TCATGA 1 cut(s) 240
CviAII CATG 4 cut(s) 76, 176, 241, 360
CviJI RGCY 4 cut(s) 110, 185, 296, 309
CviKI_1 RGCY 4 cut(s) 110, 185, 296, 309
DdeI CTNAG 1 cut(s) 106
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
EaeI YGGCCR 1 cut(s) 294
Eco130I CCWWGG 1 cut(s) 111
EcoT14I CCWWGG 1 cut(s) 111
ErhI CCWWGG 1 cut(s) 111
FaeI CATG 4 cut(s) 79, 179, 244, 363
FaiI YATR 7 cut(s) 77, 177, 242, 302, 361, 368, 373
FatI CATG 4 cut(s) 75, 175, 240, 359
FbaI TGATCA 1 cut(s) 37
FspBI CTAG 2 cut(s) 263, 306
HaeIII GGCC 1 cut(s) 296
Hin1II CATG 4 cut(s) 79, 179, 244, 363
HinfI GANTC 1 cut(s) 80
HphI GGTGA 1 cut(s) 214
Hpy188I TCNGA 1 cut(s) 164
Hpy188III TCNNGA 1 cut(s) 241
HpyAV CCTTC 1 cut(s) 32
HpyCH4III ACNGT 1 cut(s) 132
HpyCH4V TGCA 4 cut(s) 122, 141, 211, 346
HpyF3I CTNAG 1 cut(s) 106
Hsp92II CATG 4 cut(s) 79, 179, 244, 363
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 1 cut(s) 37
LpnPI CCDG 3 cut(s) 278, 335, 341
MaeI CTAG 2 cut(s) 263, 306
MaeIII GTNAC 1 cut(s) 132
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 1 cut(s) 10
MlsI TGGCCA 1 cut(s) 296
MluCI AATT 4 cut(s) 213, 226, 244, 339
MluNI TGGCCA 1 cut(s) 296
MnlI CCTC 4 cut(s) 57, 83, 115, 248
Mox20I TGGCCA 1 cut(s) 296
MscI TGGCCA 1 cut(s) 296
MseI TTAA 3 cut(s) 231, 318, 338
MslI CAYNNNNRTG 2 cut(s) 174, 358
Msp20I TGGCCA 1 cut(s) 296
NdeII GATC 1 cut(s) 37
NlaIII CATG 4 cut(s) 79, 179, 244, 363
NspI RCATGY 2 cut(s) 179, 363
PagI TCATGA 1 cut(s) 240
PfeI GAWTC 1 cut(s) 80
PstI CTGCAG 1 cut(s) 348
RseI CAYNNNNRTG 2 cut(s) 174, 358
SaqAI TTAA 3 cut(s) 231, 318, 338
Sau3AI GATC 1 cut(s) 37
SetI ASST 5 cut(s) 75, 107, 187, 307, 311
SfcI CTRYAG 2 cut(s) 190, 344
SmiMI CAYNNNNRTG 2 cut(s) 174, 358
SmlI CTYRAG 1 cut(s) 61
SmoI CTYRAG 1 cut(s) 61
SpeI ACTAGT 1 cut(s) 262
Sse9I AATT 4 cut(s) 213, 226, 244, 339
SspMI CTAG 2 cut(s) 263, 306
StyI CCWWGG 1 cut(s) 111
TaaI ACNGT 1 cut(s) 132
TasI AATT 4 cut(s) 213, 226, 244, 339
TfiI GAWTC 1 cut(s) 80
Tru1I TTAA 3 cut(s) 231, 318, 338
Tru9I TTAA 3 cut(s) 231, 318, 338
TscAI CASTG 1 cut(s) 360
TspDTI ATGAA 2 cut(s) 158, 257
TspRI CASTG 1 cut(s) 360
XceI RCATGY 2 cut(s) 179, 363
XspI CTAG 2 cut(s) 263, 306
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.