Rh7AG050900

COBRA-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0030418
Physical Location & Seq
Forward (+)
3493446 .. 3493757
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG050900.1

Sequence Viewer

Length: 312 bp
ATGGATTCAAGTCTGCTACAATCAAAAACCTCAGCCAAGGAAAATGCACCACAACTGTTACAATGCACAGAACACAACTGCCCAATCCGAGTTCATTGGCATGTGAAAGCTAACTACAGAGAGTATTGGCGTGTGCAAATTACCATCACCAATTTTAACTTCCTCATGAATTACACACAATGGACACTAGTTGTTCAGCACCCAAATCTCAACAAACTGGCCAATATACCTAGCTTCTTTCTTAACCAGCTTTTATTGCATGTGTTTAATACTGCAGATGACACTGGCATGTTTTATGGCATAAAAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
COBRA

Protein Analysis

103

Amino Acids

12.13

Weight (kDa)

8.67

Isoelectric Point (pI)

30.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
COB_C PF25079 9 - 102 1.9e-23 COBRA family C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030418)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0182411
rosa_samantha Rh7AG050900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 219
AgsI TTSAA 1 cut(s) 9
AhlI ACTAGT 1 cut(s) 187
AjuI GAANNNNNNNTTGG 2 cut(s) 143, 175
AluBI AGCT 3 cut(s) 110, 234, 250
AluI AGCT 3 cut(s) 110, 234, 250
AoxI GGCC 1 cut(s) 219
AsuHPI GGTGA 1 cut(s) 139
BalI TGGCCA 1 cut(s) 221
BbvCI CCTCAGC 1 cut(s) 31
BccI CCATC 1 cut(s) 152
BcuI ACTAGT 1 cut(s) 187
BfaI CTAG 2 cut(s) 188, 231
BfmI CTRYAG 2 cut(s) 115, 273
Bpu10I CCTNAGC 1 cut(s) 31
BsaJI CCNNGG 1 cut(s) 36
Bse1I ACTGG 2 cut(s) 222, 289
BseDI CCNNGG 1 cut(s) 36
BseMII CTCAG 1 cut(s) 45
BseNI ACTGG 2 cut(s) 222, 289
BshFI GGCC 1 cut(s) 221
BsnI GGCC 1 cut(s) 221
BspANI GGCC 1 cut(s) 221
BspCNI CTCAG 1 cut(s) 44
BspHI TCATGA 1 cut(s) 165
BspMAI CTGCAG 1 cut(s) 277
BsrI ACTGG 2 cut(s) 222, 289
BssECI CCNNGG 1 cut(s) 36
BssT1I CCWWGG 1 cut(s) 36
Bst4CI ACNGT 1 cut(s) 57
BstDEI CTNAG 1 cut(s) 31
BstMWI GCNNNNNNNGC 1 cut(s) 256
BstNSI RCATGY 3 cut(s) 104, 263, 292
BstSFI CTRYAG 2 cut(s) 115, 273
BsuRI GGCC 1 cut(s) 221
BtsIMutI CAGTG 1 cut(s) 282
CciI TCATGA 1 cut(s) 165
CviAII CATG 4 cut(s) 101, 166, 260, 289
CviJI RGCY 5 cut(s) 35, 110, 221, 234, 250
CviKI_1 RGCY 5 cut(s) 35, 110, 221, 234, 250
DdeI CTNAG 1 cut(s) 31
EaeI YGGCCR 1 cut(s) 219
Eco130I CCWWGG 1 cut(s) 36
EcoT14I CCWWGG 1 cut(s) 36
ErhI CCWWGG 1 cut(s) 36
FaeI CATG 4 cut(s) 104, 169, 263, 292
FaiI YATR 7 cut(s) 102, 167, 227, 261, 290, 297, 302
FatI CATG 4 cut(s) 100, 165, 259, 288
FspBI CTAG 2 cut(s) 188, 231
HaeIII GGCC 1 cut(s) 221
Hin1II CATG 4 cut(s) 104, 169, 263, 292
HinfI GANTC 1 cut(s) 5
HphI GGTGA 1 cut(s) 139
Hpy188I TCNGA 1 cut(s) 89
Hpy188III TCNNGA 1 cut(s) 166
HpyCH4III ACNGT 1 cut(s) 57
HpyCH4V TGCA 5 cut(s) 47, 66, 136, 259, 275
HpyF10VI GCNNNNNNNGC 1 cut(s) 256
HpyF3I CTNAG 1 cut(s) 31
Hsp92II CATG 4 cut(s) 104, 169, 263, 292
LpnPI CCDG 3 cut(s) 203, 260, 270
MaeI CTAG 2 cut(s) 188, 231
MaeIII GTNAC 1 cut(s) 57
MlsI TGGCCA 1 cut(s) 221
MluCI AATT 4 cut(s) 138, 151, 169, 307
MluNI TGGCCA 1 cut(s) 221
MnlI CCTC 2 cut(s) 40, 173
Mox20I TGGCCA 1 cut(s) 221
MscI TGGCCA 1 cut(s) 221
MseI TTAA 4 cut(s) 156, 243, 267, 310
MslI CAYNNNNRTG 2 cut(s) 99, 287
Msp20I TGGCCA 1 cut(s) 221
MwoI GCNNNNNNNGC 1 cut(s) 256
NlaIII CATG 4 cut(s) 104, 169, 263, 292
NspI RCATGY 3 cut(s) 104, 263, 292
PagI TCATGA 1 cut(s) 165
PfeI GAWTC 1 cut(s) 5
PstI CTGCAG 1 cut(s) 277
RseI CAYNNNNRTG 2 cut(s) 99, 287
SaqAI TTAA 4 cut(s) 156, 243, 267, 310
SetI ASST 5 cut(s) 32, 112, 232, 236, 252
SfcI CTRYAG 2 cut(s) 115, 273
SmiMI CAYNNNNRTG 2 cut(s) 99, 287
SpeI ACTAGT 1 cut(s) 187
Sse9I AATT 4 cut(s) 138, 151, 169, 307
SspMI CTAG 2 cut(s) 188, 231
StyI CCWWGG 1 cut(s) 36
TaaI ACNGT 1 cut(s) 57
TasI AATT 4 cut(s) 138, 151, 169, 307
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 4 cut(s) 156, 243, 267, 310
Tru9I TTAA 4 cut(s) 156, 243, 267, 310
TscAI CASTG 1 cut(s) 289
TspDTI ATGAA 2 cut(s) 83, 182
TspRI CASTG 1 cut(s) 289
XceI RCATGY 3 cut(s) 104, 263, 292
XspI CTAG 2 cut(s) 188, 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.