RchiOBHm_Chr6g0273061

Methyltransferase domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0030330
Physical Location & Seq
Forward (+)
33669429 .. 33679822
10394 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 285 bp
ATGGATTTTACTGTGATCAATTCACCCCAAATTCTAACAGCACACCCAAAATGTGGACCGAGAATTGGAGTGGATGGTAAGGAGCCTTTGGGGACTCCACTCATTAGCAAGGCCACCCAGTGTGAGGGGACTCTACTCATTAGCAAATATCCACTTTTTAAGATATACTGTCTTTCTGGATTATGTTGCCTGGGTCCTAAGCCTCTGAAGGATACAAATCTCCATGGAATATGGAAGAAAGTTCAACCTTTTGCTGACTTAGGCAGCCAAAATGGGGTCATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Methyltransf_32

Protein Analysis

94

Amino Acids

10.14

Weight (kDa)

8.9

Isoelectric Point (pI)

10.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030330)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0273061
rosa_samantha Rh6BG191700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 53
AcsI RAATTY 1 cut(s) 30
AcuI CTGAAG 1 cut(s) 227
AdeI CACNNNGTG 1 cut(s) 120
AfiI CCNNNNNNNGG 4 cut(s) 53, 65, 124, 274
AgsI TTSAA 1 cut(s) 245
AjnI CCWGG 1 cut(s) 189
AoxI GGCC 1 cut(s) 111
ApeKI GCWGC 1 cut(s) 264
ApoI RAATTY 1 cut(s) 30
AspS9I GGNCC 2 cut(s) 56, 194
AsuHPI GGTGA 1 cut(s) 15
AvaII GGWCC 2 cut(s) 56, 194
BbvI GCAGC 1 cut(s) 276
BccI CCATC 1 cut(s) 68
BciT130I CCWGG 1 cut(s) 191
BciVI GTATCC 1 cut(s) 205
BclI TGATCA 1 cut(s) 15
BfuI GTATCC 1 cut(s) 205
BisI GCNGC 1 cut(s) 265
BlsI GCNGC 1 cut(s) 266
Bme1390I CCNGG 1 cut(s) 191
Bme18I GGWCC 2 cut(s) 56, 194
BmgT120I GGNCC 2 cut(s) 56, 194
BmiI GGNNCC 2 cut(s) 84, 195
BmrFI CCNGG 1 cut(s) 191
BmrI ACTGGG 1 cut(s) 112
BmuI ACTGGG 1 cut(s) 112
Bpu10I CCTNAGC 1 cut(s) 198
BsaBI GATNNNNATC 1 cut(s) 216
BsaJI CCNNGG 2 cut(s) 190, 223
Bsc4I CCNNNNNNNGG 4 cut(s) 53, 65, 124, 274
Bse1I ACTGG 1 cut(s) 118
Bse8I GATNNNNATC 1 cut(s) 216
BseBI CCWGG 1 cut(s) 191
BseDI CCNNGG 2 cut(s) 190, 223
BseGI GGATG 1 cut(s) 79
BseJI GATNNNNATC 1 cut(s) 216
BseLI CCNNNNNNNGG 4 cut(s) 53, 65, 124, 274
BseNI ACTGG 1 cut(s) 118
BseXI GCAGC 1 cut(s) 276
BshFI GGCC 1 cut(s) 113
BslFI GGGAC 2 cut(s) 106, 142
BslI CCNNNNNNNGG 4 cut(s) 53, 65, 124, 274
BsmFI GGGAC 2 cut(s) 106, 142
BsnI GGCC 1 cut(s) 113
Bsp143I GATC 1 cut(s) 15
Bsp19I CCATGG 1 cut(s) 223
BspANI GGCC 1 cut(s) 113
BspLI GGNNCC 2 cut(s) 84, 195
BsrI ACTGG 1 cut(s) 118
BssECI CCNNGG 2 cut(s) 190, 223
BssMI GATC 1 cut(s) 15
BssT1I CCWWGG 1 cut(s) 223
Bst2UI CCWGG 1 cut(s) 191
Bst4CI ACNGT 2 cut(s) 13, 170
BstDEI CTNAG 2 cut(s) 198, 259
BstDSI CCRYGG 1 cut(s) 223
BstF5I GGATG 1 cut(s) 79
BstKTI GATC 1 cut(s) 18
BstMBI GATC 1 cut(s) 15
BstNI CCWGG 1 cut(s) 191
BstSCI CCNGG 1 cut(s) 189
BstV1I GCAGC 1 cut(s) 276
BsuI GTATCC 1 cut(s) 205
BsuRI GGCC 1 cut(s) 113
BtgI CCRYGG 1 cut(s) 223
BtsCI GGATG 1 cut(s) 79
BtsIMutI CAGTG 1 cut(s) 125
Cfr13I GGNCC 2 cut(s) 56, 194
CviAII CATG 1 cut(s) 224
CviJI RGCY 4 cut(s) 85, 113, 202, 267
CviKI_1 RGCY 4 cut(s) 85, 113, 202, 267
DdeI CTNAG 2 cut(s) 198, 259
DpnI GATC 1 cut(s) 17
DpnII GATC 1 cut(s) 15
DraIII CACNNNGTG 1 cut(s) 120
Eco130I CCWWGG 1 cut(s) 223
Eco47I GGWCC 2 cut(s) 56, 194
Eco57I CTGAAG 1 cut(s) 227
EcoO109I RGGNCCY 1 cut(s) 194
EcoRII CCWGG 1 cut(s) 189
EcoT14I CCWWGG 1 cut(s) 223
ErhI CCWWGG 1 cut(s) 223
FaeI CATG 1 cut(s) 227
FaiI YATR 4 cut(s) 166, 184, 225, 232
FaqI GGGAC 2 cut(s) 106, 142
FatI CATG 1 cut(s) 223
FbaI TGATCA 1 cut(s) 15
Fnu4HI GCNGC 1 cut(s) 265
FokI GGATG 1 cut(s) 86
Fsp4HI GCNGC 1 cut(s) 265
GluI GCNGC 1 cut(s) 265
HaeIII GGCC 1 cut(s) 113
Hin1II CATG 1 cut(s) 227
HinfI GANTC 2 cut(s) 94, 130
HphI GGTGA 1 cut(s) 15
Hpy166II GTNNAC 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 207
Hpy188III TCNNGA 1 cut(s) 177
Hpy8I GTNNAC 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 202
HpyCH4III ACNGT 2 cut(s) 13, 170
HpyF3I CTNAG 2 cut(s) 198, 259
Hsp92II CATG 1 cut(s) 227
Ksp22I TGATCA 1 cut(s) 15
Kzo9I GATC 1 cut(s) 15
LmnI GCTCC 1 cut(s) 82
LpnPI CCDG 4 cut(s) 131, 162, 176, 203
Lsp1109I GCAGC 1 cut(s) 276
MalI GATC 1 cut(s) 17
MboI GATC 1 cut(s) 15
MboII GAAGA 1 cut(s) 247
MluCI AATT 3 cut(s) 19, 30, 63
MlyI GAGTC 2 cut(s) 88, 124
MnlI CCTC 2 cut(s) 118, 213
MseI TTAA 1 cut(s) 159
MspR9I CCNGG 1 cut(s) 191
MvaI CCWGG 1 cut(s) 191
NcoI CCATGG 1 cut(s) 223
NdeII GATC 1 cut(s) 15
NlaIII CATG 1 cut(s) 227
NlaIV GGNNCC 2 cut(s) 84, 195
PflMI CCANNNNNTGG 1 cut(s) 53
PkrI GCNGC 1 cut(s) 266
PleI GAGTC 2 cut(s) 88, 124
PpsI GAGTC 2 cut(s) 88, 124
PpuMI RGGWCCY 1 cut(s) 194
Psp5II RGGWCCY 1 cut(s) 194
Psp6I CCWGG 1 cut(s) 189
PspGI CCWGG 1 cut(s) 189
PspN4I GGNNCC 2 cut(s) 84, 195
PspPI GGNCC 2 cut(s) 56, 194
PspPPI RGGWCCY 1 cut(s) 194
SaqAI TTAA 1 cut(s) 159
SatI GCNGC 1 cut(s) 265
Sau3AI GATC 1 cut(s) 15
Sau96I GGNCC 2 cut(s) 56, 194
SchI GAGTC 2 cut(s) 88, 124
ScrFI CCNGG 1 cut(s) 191
SetI ASST 1 cut(s) 250
SgeI CNNG 7 cut(s) 72, 121, 130, 189, 202, 203, 236
SinI GGWCC 2 cut(s) 56, 194
Sse9I AATT 3 cut(s) 19, 30, 63
StyD4I CCNGG 1 cut(s) 189
StyI CCWWGG 1 cut(s) 223
TaaI ACNGT 2 cut(s) 13, 170
TaqII GACCGA 1 cut(s) 73
TasI AATT 3 cut(s) 19, 30, 63
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TscAI CASTG 1 cut(s) 125
TseI GCWGC 1 cut(s) 264
TspRI CASTG 1 cut(s) 125
Van91I CCANNNNNTGG 1 cut(s) 53
VpaK11BI GGWCC 2 cut(s) 56, 194
XapI RAATTY 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.