RchiOBHm_Chr5g0008751

tRNA synthetases class II (A)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
5694382 .. 5694676
295 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGGTTAATTTGATGAGTTTGAATTTCTGGTTTCACTCAGCTAAGCATTTGCTAGATGTATGTATGAAGAATGTGGGATTAGGTGATTTAAAGCCACGCAAAGGCTACCATTTCCCTCAAGGGTATGATTTACTCCATTATCTACCACCTAGAATAGATGTTGTGGTTATGTTTCTTATCTTTCTGTAA

Protein Analysis

62

Amino Acids

7.29

Weight (kDa)

8.93

Isoelectric Point (pI)

32.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030189)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0008751
rosa_rugosa Rorug06G0081700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 22
AfiI CCNNNNNNNGG 1 cut(s) 101
AgsI TTSAA 1 cut(s) 22
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
ApoI RAATTY 1 cut(s) 22
AsuHPI GGTGA 1 cut(s) 95
BfaI CTAG 2 cut(s) 53, 150
BlpI GCTNAGC 1 cut(s) 42
Bpu1102I GCTNAGC 1 cut(s) 42
BpuEI CTTGAG 1 cut(s) 102
Bsc4I CCNNNNNNNGG 1 cut(s) 101
BseLI CCNNNNNNNGG 1 cut(s) 101
BseMII CTCAG 1 cut(s) 51
BslI CCNNNNNNNGG 1 cut(s) 101
Bsp1720I GCTNAGC 1 cut(s) 42
BspCNI CTCAG 1 cut(s) 50
BstDEI CTNAG 2 cut(s) 37, 42
CviJI RGCY 3 cut(s) 41, 94, 105
CviKI_1 RGCY 3 cut(s) 41, 94, 105
DdeI CTNAG 2 cut(s) 37, 42
DraI TTTAAA 1 cut(s) 90
FaiI YATR 4 cut(s) 61, 65, 126, 170
FspBI CTAG 2 cut(s) 53, 150
HphI GGTGA 1 cut(s) 95
HpyF3I CTNAG 2 cut(s) 37, 42
LpnPI CCDG 1 cut(s) 13
MaeI CTAG 2 cut(s) 53, 150
MboII GAAGA 1 cut(s) 79
MluCI AATT 2 cut(s) 7, 22
MnlI CCTC 1 cut(s) 126
MseI TTAA 2 cut(s) 6, 89
SaqAI TTAA 2 cut(s) 6, 89
SetI ASST 3 cut(s) 43, 85, 151
SgeI CNNG 5 cut(s) 40, 65, 108, 131, 162
SmlI CTYRAG 1 cut(s) 117
SmoI CTYRAG 1 cut(s) 117
Sse9I AATT 2 cut(s) 7, 22
SspMI CTAG 2 cut(s) 53, 150
TasI AATT 2 cut(s) 7, 22
Tru1I TTAA 2 cut(s) 6, 89
Tru9I TTAA 2 cut(s) 6, 89
TspDTI ATGAA 1 cut(s) 80
XapI RAATTY 1 cut(s) 22
XspI CTAG 2 cut(s) 53, 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.