RchiOBHm_Chr5g0009051

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
5967038 .. 5968091
1054 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 135 bp
ATGATGGTGGAGTTATTTGTGTTGGGGTGCACAGGAATTGTCATGTTTCTTCACGGAGCCAACTTCGTCTTCCACCTTATTTCCCAACACTTTGTATTTCGATCTATCAGCTTTCTGGGATTCGTTGGGTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

44

Amino Acids

5.04

Weight (kDa)

6.8

Isoelectric Point (pI)

15.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028157)

Species Orthologous Gene IDs
malus_domestica MD10G1290100.v1.1
rosa_chinensis RchiOBHm_Chr5g0009051

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjuI GAANNNNNNNTTGG 2 cut(s) 53, 85
AluBI AGCT 1 cut(s) 111
AluI AGCT 1 cut(s) 111
Alw21I GWGCWC 1 cut(s) 32
Alw44I GTGCAC 1 cut(s) 28
ApaLI GTGCAC 1 cut(s) 28
BaeGI GKGCMC 1 cut(s) 32
BbsI GAAGAC 1 cut(s) 61
Bbv12I GWGCWC 1 cut(s) 32
BmiI GGNNCC 1 cut(s) 58
BpiI GAAGAC 1 cut(s) 61
BseSI GKGCMC 1 cut(s) 32
BsiHKAI GWGCWC 1 cut(s) 32
Bsp1286I GDGCHC 1 cut(s) 32
Bsp143I GATC 1 cut(s) 101
BspLI GGNNCC 1 cut(s) 58
BssMI GATC 1 cut(s) 101
BstKTI GATC 1 cut(s) 104
BstMBI GATC 1 cut(s) 101
BstSLI GKGCMC 1 cut(s) 32
BstV2I GAAGAC 1 cut(s) 61
CviAII CATG 1 cut(s) 43
CviJI RGCY 2 cut(s) 59, 111
CviKI_1 RGCY 2 cut(s) 59, 111
DpnI GATC 1 cut(s) 103
DpnII GATC 1 cut(s) 101
FaeI CATG 1 cut(s) 46
FaiI YATR 1 cut(s) 44
FatI CATG 1 cut(s) 42
Hin1II CATG 1 cut(s) 46
HinfI GANTC 1 cut(s) 120
Hpy166II GTNNAC 1 cut(s) 30
Hpy8I GTNNAC 1 cut(s) 30
HpyCH4V TGCA 1 cut(s) 30
Hsp92II CATG 1 cut(s) 46
Kzo9I GATC 1 cut(s) 101
LmnI GCTCC 1 cut(s) 56
LpnPI CCDG 2 cut(s) 18, 101
MalI GATC 1 cut(s) 103
MboI GATC 1 cut(s) 101
MboII GAAGA 2 cut(s) 41, 61
MhlI GDGCHC 1 cut(s) 32
MluCI AATT 1 cut(s) 36
NdeII GATC 1 cut(s) 101
NlaIII CATG 1 cut(s) 46
NlaIV GGNNCC 1 cut(s) 58
PfeI GAWTC 1 cut(s) 120
PspN4I GGNNCC 1 cut(s) 58
Sau3AI GATC 1 cut(s) 101
SduI GDGCHC 1 cut(s) 32
SetI ASST 2 cut(s) 78, 113
SgeI CNNG 4 cut(s) 45, 55, 65, 128
Sse9I AATT 1 cut(s) 36
TaqI TCGA 1 cut(s) 100
TasI AATT 1 cut(s) 36
TfiI GAWTC 1 cut(s) 120
TspGWI ACGGA 1 cut(s) 69
VneI GTGCAC 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.