RchiOBHm_Chr5g0009721

BEST Arabidopsis thaliana protein match is

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
6431280 .. 6433763
2484 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 222 bp
ATGCTTAGATCTATAAGGATTTGGAAGAAATACCCATGGCTGATGATCTACCTCAGAGCTGATGCAACAAAAGGATTTCCTAGGGGCTATCACTATATATGTTTCAACGGGAATGCTCAAAACTACTATCTTTCGGTCATCAACATGGACACTCTCACTTTGTTTAATAGATGGTTTGGAATACAGCTGAATCTTCAGTCTATGGGCATCGACCTCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.78

Weight (kDa)

9.84

Isoelectric Point (pI)

40.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7705 PF24804 4 - 33 3.6e-10 Domain of unknown function (DUF7705)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030130)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0009721
rosa_roxburghii Rroxscaffold_1G00066490

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 179
AgsI TTSAA 1 cut(s) 106
AluBI AGCT 2 cut(s) 59, 187
AluI AGCT 2 cut(s) 59, 187
AspA2I CCTAGG 1 cut(s) 80
AvrII CCTAGG 1 cut(s) 80
BccI CCATC 1 cut(s) 165
BfaI CTAG 1 cut(s) 81
BglII AGATCT 1 cut(s) 8
BlnI CCTAGG 1 cut(s) 80
BmsI GCATC 2 cut(s) 52, 216
BpuEI CTTGAG 1 cut(s) 200
BsaJI CCNNGG 2 cut(s) 35, 80
BseDI CCNNGG 2 cut(s) 35, 80
BseMII CTCAG 1 cut(s) 67
BsmI GAATGC 1 cut(s) 118
Bsp143I GATC 2 cut(s) 8, 45
Bsp19I CCATGG 1 cut(s) 35
BspCNI CTCAG 1 cut(s) 66
BssECI CCNNGG 2 cut(s) 35, 80
BssMI GATC 2 cut(s) 8, 45
BssT1I CCWWGG 2 cut(s) 35, 80
BstDEI CTNAG 2 cut(s) 5, 53
BstDSI CCRYGG 1 cut(s) 35
BstKTI GATC 2 cut(s) 11, 48
BstMBI GATC 2 cut(s) 8, 45
BstX2I RGATCY 1 cut(s) 8
BstYI RGATCY 1 cut(s) 8
BtgI CCRYGG 1 cut(s) 35
CviAII CATG 2 cut(s) 36, 145
CviJI RGCY 4 cut(s) 40, 59, 87, 187
CviKI_1 RGCY 4 cut(s) 40, 59, 87, 187
DdeI CTNAG 2 cut(s) 5, 53
DpnI GATC 2 cut(s) 10, 47
DpnII GATC 2 cut(s) 8, 45
Eco130I CCWWGG 2 cut(s) 35, 80
Eco57I CTGAAG 1 cut(s) 179
EcoT14I CCWWGG 2 cut(s) 35, 80
ErhI CCWWGG 2 cut(s) 35, 80
FaeI CATG 2 cut(s) 39, 148
FaiI YATR 7 cut(s) 14, 37, 96, 98, 100, 146, 203
FatI CATG 2 cut(s) 35, 144
FspBI CTAG 1 cut(s) 81
Hin1II CATG 2 cut(s) 39, 148
HinfI GANTC 1 cut(s) 190
Hpy188I TCNGA 1 cut(s) 56
HpyCH4V TGCA 1 cut(s) 65
HpyF3I CTNAG 2 cut(s) 5, 53
Hsp92II CATG 2 cut(s) 39, 148
Kzo9I GATC 2 cut(s) 8, 45
LweI GCATC 2 cut(s) 52, 216
MaeI CTAG 1 cut(s) 81
MalI GATC 2 cut(s) 10, 47
MboI GATC 2 cut(s) 8, 45
MboII GAAGA 2 cut(s) 37, 185
MflI RGATCY 1 cut(s) 8
MnlI CCTC 1 cut(s) 62
MseI TTAA 1 cut(s) 165
MslI CAYNNNNRTG 1 cut(s) 143
MspA1I CMGCKG 1 cut(s) 187
Mva1269I GAATGC 1 cut(s) 118
NcoI CCATGG 1 cut(s) 35
NdeII GATC 2 cut(s) 8, 45
NlaIII CATG 2 cut(s) 39, 148
PctI GAATGC 1 cut(s) 118
PfeI GAWTC 1 cut(s) 190
PsuI RGATCY 1 cut(s) 8
PvuII CAGCTG 1 cut(s) 187
RseI CAYNNNNRTG 1 cut(s) 143
SaqAI TTAA 1 cut(s) 165
Sau3AI GATC 2 cut(s) 8, 45
SetI ASST 4 cut(s) 54, 61, 189, 216
SfaNI GCATC 2 cut(s) 52, 216
SgeI CNNG 4 cut(s) 48, 93, 121, 157
SmiMI CAYNNNNRTG 1 cut(s) 143
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
SspMI CTAG 1 cut(s) 81
StyI CCWWGG 2 cut(s) 35, 80
TaqI TCGA 1 cut(s) 210
TaqII GACCGA 1 cut(s) 124
TfiI GAWTC 1 cut(s) 190
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
XmaJI CCTAGG 1 cut(s) 80
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.