Rroxscaffold_1G00066490

Ergosterol biosynthesis ERG4/ERG24 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
88024698 .. 88026951
2254 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00066490.1

Sequence Viewer

Length: 204 bp
ATGATATTTGTTGGAGCTGTATGTTGCTTTTGGTCTTCCCAGAATTATTACTTTACTTCCAGTTTAACTGCCATTCATGATTCAAGACAATATCTTTCGATCATCAACATGGACACTCTGACTTTGTTTAATAGATGGTTTGGAATACAGCTGAATCCTCAGTCTATGGGCATCGACCTCAAGTATTATTCAGAATCTTATTGA

Protein Analysis

67

Amino Acids

7.88

Weight (kDa)

5.41

Isoelectric Point (pI)

46.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030130)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0009721
rosa_roxburghii Rroxscaffold_1G00066490

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 84
AluBI AGCT 2 cut(s) 17, 151
AluI AGCT 2 cut(s) 17, 151
BbsI GAAGAC 1 cut(s) 27
BccI CCATC 1 cut(s) 129
BmsI GCATC 1 cut(s) 180
BpiI GAAGAC 1 cut(s) 27
BpuEI CTTGAG 1 cut(s) 164
Bse1I ACTGG 1 cut(s) 60
BseMII CTCAG 1 cut(s) 173
BseNI ACTGG 1 cut(s) 60
Bsp143I GATC 1 cut(s) 99
BspCNI CTCAG 1 cut(s) 172
BspHI TCATGA 1 cut(s) 76
BsrI ACTGG 1 cut(s) 60
BssMI GATC 1 cut(s) 99
BstDEI CTNAG 1 cut(s) 159
BstKTI GATC 1 cut(s) 102
BstMBI GATC 1 cut(s) 99
BstV2I GAAGAC 1 cut(s) 27
CciI TCATGA 1 cut(s) 76
CviAII CATG 2 cut(s) 77, 109
CviJI RGCY 2 cut(s) 17, 151
CviKI_1 RGCY 2 cut(s) 17, 151
DdeI CTNAG 1 cut(s) 159
DpnI GATC 1 cut(s) 101
DpnII GATC 1 cut(s) 99
FaeI CATG 2 cut(s) 80, 112
FaiI YATR 4 cut(s) 22, 78, 110, 167
FatI CATG 2 cut(s) 76, 108
Hin1II CATG 2 cut(s) 80, 112
HinfI GANTC 3 cut(s) 80, 154, 194
Hpy188I TCNGA 2 cut(s) 120, 193
Hpy188III TCNNGA 2 cut(s) 77, 84
HpyF3I CTNAG 1 cut(s) 159
Hsp92II CATG 2 cut(s) 80, 112
Kzo9I GATC 1 cut(s) 99
LmnI GCTCC 1 cut(s) 14
LpnPI CCDG 2 cut(s) 53, 73
LweI GCATC 1 cut(s) 180
MalI GATC 1 cut(s) 101
MboI GATC 1 cut(s) 99
MboII GAAGA 1 cut(s) 27
MluCI AATT 1 cut(s) 43
MnlI CCTC 2 cut(s) 168, 188
MseI TTAA 2 cut(s) 65, 129
MslI CAYNNNNRTG 1 cut(s) 107
MspA1I CMGCKG 1 cut(s) 151
NdeII GATC 1 cut(s) 99
NlaIII CATG 2 cut(s) 80, 112
PagI TCATGA 1 cut(s) 76
PfeI GAWTC 3 cut(s) 80, 154, 194
PvuII CAGCTG 1 cut(s) 151
RseI CAYNNNNRTG 1 cut(s) 107
SaqAI TTAA 2 cut(s) 65, 129
Sau3AI GATC 1 cut(s) 99
SetI ASST 3 cut(s) 19, 153, 180
SfaNI GCATC 1 cut(s) 180
SgeI CNNG 6 cut(s) 52, 72, 89, 96, 121, 193
SmiMI CAYNNNNRTG 1 cut(s) 107
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 1 cut(s) 43
TaqI TCGA 2 cut(s) 98, 174
TasI AATT 1 cut(s) 43
TfiI GAWTC 3 cut(s) 80, 154, 194
Tru1I TTAA 2 cut(s) 65, 129
Tru9I TTAA 2 cut(s) 65, 129
TspDTI ATGAA 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.